Incidental Mutation 'R1529:Fgd3'
ID166486
Institutional Source Beutler Lab
Gene Symbol Fgd3
Ensembl Gene ENSMUSG00000037946
Gene NameFYVE, RhoGEF and PH domain containing 3
SynonymsZFYVE5, 5830461L01Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R1529 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location49261554-49320311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49266694 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 569 (N569S)
Ref Sequence ENSEMBL: ENSMUSP00000105714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048716] [ENSMUST00000110087]
Predicted Effect probably benign
Transcript: ENSMUST00000048716
AA Change: N569S

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000048692
Gene: ENSMUSG00000037946
AA Change: N569S

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
RhoGEF 157 336 1.41e-58 SMART
PH 367 467 3.01e-17 SMART
FYVE 520 585 1.78e-7 SMART
PH 613 713 2.81e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110087
AA Change: N569S

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105714
Gene: ENSMUSG00000037946
AA Change: N569S

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
RhoGEF 157 336 1.41e-58 SMART
PH 367 467 3.01e-17 SMART
FYVE 520 585 1.78e-7 SMART
PH 613 713 2.81e-8 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik G A 17: 47,413,890 S102L probably benign Het
A430105I19Rik T A 2: 118,761,760 probably null Het
Adam11 T C 11: 102,775,113 probably null Het
AI314180 T C 4: 58,832,701 probably null Het
Amd1 A T 10: 40,290,505 M194K probably benign Het
Ap1b1 T G 11: 5,039,547 F793C probably damaging Het
Arfgef3 G A 10: 18,613,222 R1292* probably null Het
Arhgef5 C A 6: 43,279,515 H1186N probably damaging Het
Atad1 A G 19: 32,706,921 F26L probably benign Het
Atg2b C T 12: 105,661,133 V532I probably benign Het
Atp2b4 A G 1: 133,717,988 F943L probably damaging Het
Atp7b G A 8: 22,028,724 L21F possibly damaging Het
Cenpf A T 1: 189,660,038 D532E probably benign Het
Ckmt2 A T 13: 91,861,201 D202E probably benign Het
Crim1 A C 17: 78,367,954 K864T probably benign Het
Ctnnd2 A G 15: 30,887,121 R765G possibly damaging Het
Ddx10 T A 9: 53,117,199 R802* probably null Het
Dnah7b T A 1: 46,177,281 F1152L probably damaging Het
Dsg1c T C 18: 20,282,023 L659P probably damaging Het
Dzank1 A G 2: 144,482,188 F577L probably benign Het
Eci3 T C 13: 34,956,920 D93G probably benign Het
Ep400 C A 5: 110,739,445 V591L probably benign Het
Fam126b A T 1: 58,539,607 D261E probably benign Het
Ghsr T A 3: 27,372,482 V229E probably damaging Het
Gm8298 T C 3: 59,861,112 I21T probably benign Het
Gna15 T A 10: 81,509,342 I230F probably damaging Het
Gnl2 A G 4: 125,046,306 S324G probably damaging Het
Grid1 T C 14: 35,309,293 V281A probably benign Het
Hebp2 G A 10: 18,545,761 A12V possibly damaging Het
Hfm1 T C 5: 106,853,123 D1254G probably benign Het
Hif3a A C 7: 17,042,639 S459A probably benign Het
Hnrnpl T A 7: 28,813,923 N149K possibly damaging Het
Hoxc10 A T 15: 102,967,200 S115C probably damaging Het
Ifnab T C 4: 88,691,055 D58G possibly damaging Het
Itfg1 T C 8: 85,810,614 T195A probably benign Het
Itpr3 T A 17: 27,105,485 probably null Het
Iws1 A G 18: 32,080,281 D254G probably benign Het
Kl C A 5: 150,988,941 D718E probably benign Het
Lrit2 A G 14: 37,068,827 I154M probably benign Het
Lrp2 T C 2: 69,523,182 D578G probably damaging Het
Lss T G 10: 76,536,289 Y159* probably null Het
Mab21l1 C A 3: 55,783,833 Y280* probably null Het
Maf A T 8: 115,693,170 S378T probably benign Het
Mast2 C T 4: 116,430,519 V59I probably benign Het
Nisch C T 14: 31,180,938 probably benign Het
Nova2 A T 7: 18,957,554 N139Y probably damaging Het
Nup210 C A 6: 91,036,376 D434Y probably damaging Het
Nvl C T 1: 181,109,159 probably null Het
Olfr1049 A T 2: 86,255,241 Y151N probably damaging Het
Olfr1087 A G 2: 86,690,333 V214A possibly damaging Het
Olfr577 A G 7: 102,973,879 Y38H probably damaging Het
Olfr657 A G 7: 104,636,489 T272A probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pbx3 T C 2: 34,204,859 Y255C probably damaging Het
Pcyt1a G A 16: 32,451,793 E27K possibly damaging Het
Pex6 A T 17: 46,714,064 T348S probably benign Het
Phf21b A G 15: 84,797,396 I251T probably damaging Het
Pkd2l2 T C 18: 34,430,702 I490T probably damaging Het
Pla2g12a T A 3: 129,878,885 L56Q probably damaging Het
Plk4 A G 3: 40,806,536 T434A probably benign Het
Ptpn13 A G 5: 103,564,132 N1632S probably benign Het
Rfpl4 C T 7: 5,110,712 V151M probably damaging Het
Rpain G C 11: 70,974,915 E169Q probably damaging Het
Samd8 T A 14: 21,775,159 V124D possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc12a1 C T 2: 125,190,295 T622I probably damaging Het
Slc17a3 T A 13: 23,845,445 V67D probably damaging Het
Slc41a3 G T 6: 90,644,216 V387L probably damaging Het
Slitrk1 T A 14: 108,913,277 M1L probably benign Het
Stat4 T C 1: 52,011,793 W4R probably damaging Het
Tas2r126 A G 6: 42,434,568 T12A probably benign Het
Tbc1d24 A G 17: 24,185,979 C64R probably damaging Het
Tcaf2 T C 6: 42,629,506 S505G probably benign Het
Tiam2 T C 17: 3,516,703 V1506A probably benign Het
Tmem9b A C 7: 109,736,949 S163A probably benign Het
Tmtc2 G A 10: 105,303,658 S669L probably damaging Het
Tnpo3 A T 6: 29,560,221 I641K possibly damaging Het
Ttn C T 2: 76,735,367 A28214T probably damaging Het
Utp11 G A 4: 124,683,239 A113V probably benign Het
Utp20 G A 10: 88,753,006 R2434C probably damaging Het
Vmn1r60 A T 7: 5,544,903 I66N probably benign Het
Zeb2 T C 2: 44,997,194 E572G probably damaging Het
Other mutations in Fgd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Fgd3 APN 13 49275643 splice site probably benign
IGL00816:Fgd3 APN 13 49264786 splice site probably benign
IGL01797:Fgd3 APN 13 49289589 missense probably damaging 1.00
IGL01993:Fgd3 APN 13 49280188 missense possibly damaging 0.62
IGL02134:Fgd3 APN 13 49296749 missense possibly damaging 0.84
IGL02327:Fgd3 APN 13 49285798 missense probably damaging 1.00
IGL02367:Fgd3 APN 13 49287326 missense probably damaging 1.00
IGL02532:Fgd3 APN 13 49285761 missense probably damaging 1.00
IGL02830:Fgd3 APN 13 49264631 splice site probably benign
IGL02888:Fgd3 APN 13 49281816 critical splice donor site probably null
IGL03209:Fgd3 APN 13 49285818 missense probably damaging 1.00
R0016:Fgd3 UTSW 13 49296609 missense probably benign 0.10
R0016:Fgd3 UTSW 13 49296609 missense probably benign 0.10
R0064:Fgd3 UTSW 13 49296425 missense possibly damaging 0.73
R0064:Fgd3 UTSW 13 49296425 missense possibly damaging 0.73
R0285:Fgd3 UTSW 13 49263948 missense possibly damaging 0.89
R0526:Fgd3 UTSW 13 49296524 missense probably benign 0.00
R0617:Fgd3 UTSW 13 49264697 missense possibly damaging 0.80
R0648:Fgd3 UTSW 13 49296573 missense probably benign 0.23
R1577:Fgd3 UTSW 13 49281937 missense probably damaging 0.99
R1913:Fgd3 UTSW 13 49263848 missense possibly damaging 0.89
R2002:Fgd3 UTSW 13 49296455 missense probably benign 0.05
R4342:Fgd3 UTSW 13 49273709 critical splice donor site probably null
R4606:Fgd3 UTSW 13 49296560 missense probably damaging 1.00
R4810:Fgd3 UTSW 13 49289650 missense probably benign 0.01
R4885:Fgd3 UTSW 13 49263989 missense possibly damaging 0.66
R4962:Fgd3 UTSW 13 49266629 missense probably benign 0.03
R4974:Fgd3 UTSW 13 49278602 missense probably damaging 1.00
R5201:Fgd3 UTSW 13 49296378 missense probably benign 0.00
R5524:Fgd3 UTSW 13 49277577 missense probably damaging 0.97
R5588:Fgd3 UTSW 13 49287310 missense probably damaging 1.00
R5710:Fgd3 UTSW 13 49296729 missense probably benign 0.00
R5753:Fgd3 UTSW 13 49274940 missense possibly damaging 0.94
R6048:Fgd3 UTSW 13 49273748 missense probably benign 0.01
R6086:Fgd3 UTSW 13 49287296 missense probably benign 0.12
R7293:Fgd3 UTSW 13 49264658 missense probably benign 0.00
R7311:Fgd3 UTSW 13 49296690 missense possibly damaging 0.94
R7383:Fgd3 UTSW 13 49268309 missense possibly damaging 0.50
R8205:Fgd3 UTSW 13 49296347 missense probably benign 0.11
Z1176:Fgd3 UTSW 13 49281826 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTCACCTCCAGTCAGACCCAG -3'
(R):5'- GGGCACTCAAGGAGACTAAAGTCAC -3'

Sequencing Primer
(F):5'- TATAAGTGGTTCCCAGGCAC -3'
(R):5'- GGAGACTAAAGTCACTCTCTGC -3'
Posted On2014-04-13