Incidental Mutation 'R1529:Tiam2'
ID166499
Institutional Source Beutler Lab
Gene Symbol Tiam2
Ensembl Gene ENSMUSG00000023800
Gene NameT cell lymphoma invasion and metastasis 2
Synonyms3000002F19Rik, STEF
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1529 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location3326573-3531344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3516703 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1506 (V1506A)
Ref Sequence ENSEMBL: ENSMUSP00000125842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041003] [ENSMUST00000072156] [ENSMUST00000169838] [ENSMUST00000227405]
Predicted Effect probably benign
Transcript: ENSMUST00000041003
SMART Domains Protein: ENSMUSP00000035291
Gene: ENSMUSG00000036983

DomainStartEndE-ValueType
rADc 43 234 5.56e-69 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072156
AA Change: V1506A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072020
Gene: ENSMUSG00000023800
AA Change: V1506A

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169838
AA Change: V1506A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125842
Gene: ENSMUSG00000023800
AA Change: V1506A

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226997
Predicted Effect probably benign
Transcript: ENSMUST00000227405
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor. A highly similar mouse protein specifically activates ras-related C3 botulinum substrate 1, converting this Rho-like guanosine triphosphatase (GTPase) from a guanosine diphosphate-bound inactive state to a guanosine triphosphate-bound active state. The encoded protein may play a role in neural cell development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik G A 17: 47,413,890 S102L probably benign Het
A430105I19Rik T A 2: 118,761,760 probably null Het
Adam11 T C 11: 102,775,113 probably null Het
AI314180 T C 4: 58,832,701 probably null Het
Amd1 A T 10: 40,290,505 M194K probably benign Het
Ap1b1 T G 11: 5,039,547 F793C probably damaging Het
Arfgef3 G A 10: 18,613,222 R1292* probably null Het
Arhgef5 C A 6: 43,279,515 H1186N probably damaging Het
Atad1 A G 19: 32,706,921 F26L probably benign Het
Atg2b C T 12: 105,661,133 V532I probably benign Het
Atp2b4 A G 1: 133,717,988 F943L probably damaging Het
Atp7b G A 8: 22,028,724 L21F possibly damaging Het
Cenpf A T 1: 189,660,038 D532E probably benign Het
Ckmt2 A T 13: 91,861,201 D202E probably benign Het
Crim1 A C 17: 78,367,954 K864T probably benign Het
Ctnnd2 A G 15: 30,887,121 R765G possibly damaging Het
Ddx10 T A 9: 53,117,199 R802* probably null Het
Dnah7b T A 1: 46,177,281 F1152L probably damaging Het
Dsg1c T C 18: 20,282,023 L659P probably damaging Het
Dzank1 A G 2: 144,482,188 F577L probably benign Het
Eci3 T C 13: 34,956,920 D93G probably benign Het
Ep400 C A 5: 110,739,445 V591L probably benign Het
Fam126b A T 1: 58,539,607 D261E probably benign Het
Fgd3 T C 13: 49,266,694 N569S probably benign Het
Ghsr T A 3: 27,372,482 V229E probably damaging Het
Gm8298 T C 3: 59,861,112 I21T probably benign Het
Gna15 T A 10: 81,509,342 I230F probably damaging Het
Gnl2 A G 4: 125,046,306 S324G probably damaging Het
Grid1 T C 14: 35,309,293 V281A probably benign Het
Hebp2 G A 10: 18,545,761 A12V possibly damaging Het
Hfm1 T C 5: 106,853,123 D1254G probably benign Het
Hif3a A C 7: 17,042,639 S459A probably benign Het
Hnrnpl T A 7: 28,813,923 N149K possibly damaging Het
Hoxc10 A T 15: 102,967,200 S115C probably damaging Het
Ifnab T C 4: 88,691,055 D58G possibly damaging Het
Itfg1 T C 8: 85,810,614 T195A probably benign Het
Itpr3 T A 17: 27,105,485 probably null Het
Iws1 A G 18: 32,080,281 D254G probably benign Het
Kl C A 5: 150,988,941 D718E probably benign Het
Lrit2 A G 14: 37,068,827 I154M probably benign Het
Lrp2 T C 2: 69,523,182 D578G probably damaging Het
Lss T G 10: 76,536,289 Y159* probably null Het
Mab21l1 C A 3: 55,783,833 Y280* probably null Het
Maf A T 8: 115,693,170 S378T probably benign Het
Mast2 C T 4: 116,430,519 V59I probably benign Het
Nisch C T 14: 31,180,938 probably benign Het
Nova2 A T 7: 18,957,554 N139Y probably damaging Het
Nup210 C A 6: 91,036,376 D434Y probably damaging Het
Nvl C T 1: 181,109,159 probably null Het
Olfr1049 A T 2: 86,255,241 Y151N probably damaging Het
Olfr1087 A G 2: 86,690,333 V214A possibly damaging Het
Olfr577 A G 7: 102,973,879 Y38H probably damaging Het
Olfr657 A G 7: 104,636,489 T272A probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pbx3 T C 2: 34,204,859 Y255C probably damaging Het
Pcyt1a G A 16: 32,451,793 E27K possibly damaging Het
Pex6 A T 17: 46,714,064 T348S probably benign Het
Phf21b A G 15: 84,797,396 I251T probably damaging Het
Pkd2l2 T C 18: 34,430,702 I490T probably damaging Het
Pla2g12a T A 3: 129,878,885 L56Q probably damaging Het
Plk4 A G 3: 40,806,536 T434A probably benign Het
Ptpn13 A G 5: 103,564,132 N1632S probably benign Het
Rfpl4 C T 7: 5,110,712 V151M probably damaging Het
Rpain G C 11: 70,974,915 E169Q probably damaging Het
Samd8 T A 14: 21,775,159 V124D possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc12a1 C T 2: 125,190,295 T622I probably damaging Het
Slc17a3 T A 13: 23,845,445 V67D probably damaging Het
Slc41a3 G T 6: 90,644,216 V387L probably damaging Het
Slitrk1 T A 14: 108,913,277 M1L probably benign Het
Stat4 T C 1: 52,011,793 W4R probably damaging Het
Tas2r126 A G 6: 42,434,568 T12A probably benign Het
Tbc1d24 A G 17: 24,185,979 C64R probably damaging Het
Tcaf2 T C 6: 42,629,506 S505G probably benign Het
Tmem9b A C 7: 109,736,949 S163A probably benign Het
Tmtc2 G A 10: 105,303,658 S669L probably damaging Het
Tnpo3 A T 6: 29,560,221 I641K possibly damaging Het
Ttn C T 2: 76,735,367 A28214T probably damaging Het
Utp11 G A 4: 124,683,239 A113V probably benign Het
Utp20 G A 10: 88,753,006 R2434C probably damaging Het
Vmn1r60 A T 7: 5,544,903 I66N probably benign Het
Zeb2 T C 2: 44,997,194 E572G probably damaging Het
Other mutations in Tiam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Tiam2 APN 17 3415028 missense probably benign 0.21
IGL01320:Tiam2 APN 17 3505745 missense probably damaging 1.00
IGL01384:Tiam2 APN 17 3427202 missense probably benign 0.08
IGL01575:Tiam2 APN 17 3454316 missense probably damaging 1.00
IGL01769:Tiam2 APN 17 3427290 missense probably damaging 1.00
IGL02395:Tiam2 APN 17 3421481 missense possibly damaging 0.49
IGL02652:Tiam2 APN 17 3439696 splice site probably benign
IGL03102:Tiam2 APN 17 3509548 missense probably damaging 1.00
IGL03222:Tiam2 APN 17 3438708 missense probably damaging 0.97
Feste_burg UTSW 17 3414622 frame shift probably null
R0257:Tiam2 UTSW 17 3450813 missense possibly damaging 0.49
R0420:Tiam2 UTSW 17 3502918 missense probably benign 0.01
R0528:Tiam2 UTSW 17 3511071 missense probably damaging 1.00
R0532:Tiam2 UTSW 17 3421646 missense probably damaging 1.00
R0551:Tiam2 UTSW 17 3428954 missense probably damaging 1.00
R0554:Tiam2 UTSW 17 3438681 nonsense probably null
R0645:Tiam2 UTSW 17 3514698 missense possibly damaging 0.92
R0726:Tiam2 UTSW 17 3512833 unclassified probably benign
R1139:Tiam2 UTSW 17 3477267 missense possibly damaging 0.55
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1671:Tiam2 UTSW 17 3506834 missense probably damaging 1.00
R1731:Tiam2 UTSW 17 3518423 missense probably damaging 0.98
R1759:Tiam2 UTSW 17 3516003 missense probably damaging 0.98
R1850:Tiam2 UTSW 17 3437235 missense probably damaging 1.00
R1853:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1855:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1931:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1932:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1993:Tiam2 UTSW 17 3415126 nonsense probably null
R2211:Tiam2 UTSW 17 3414918 nonsense probably null
R2217:Tiam2 UTSW 17 3415114 missense probably benign 0.34
R2278:Tiam2 UTSW 17 3427220 missense probably damaging 0.96
R2407:Tiam2 UTSW 17 3477261 missense probably benign 0.14
R2516:Tiam2 UTSW 17 3453382 missense probably damaging 1.00
R2991:Tiam2 UTSW 17 3518250 missense probably benign
R3086:Tiam2 UTSW 17 3421582 missense probably damaging 1.00
R3121:Tiam2 UTSW 17 3439702 missense probably benign 0.01
R3686:Tiam2 UTSW 17 3421684 missense possibly damaging 0.87
R3740:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3742:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3826:Tiam2 UTSW 17 3507701 splice site probably benign
R3829:Tiam2 UTSW 17 3507701 splice site probably benign
R3844:Tiam2 UTSW 17 3421651 missense probably damaging 0.98
R3970:Tiam2 UTSW 17 3428831 missense probably damaging 1.00
R4060:Tiam2 UTSW 17 3428980 missense probably benign 0.00
R4296:Tiam2 UTSW 17 3450845 missense probably benign
R4357:Tiam2 UTSW 17 3450853 missense probably damaging 1.00
R4368:Tiam2 UTSW 17 3414683 missense probably benign 0.01
R4369:Tiam2 UTSW 17 3413967 start gained probably benign
R4524:Tiam2 UTSW 17 3514711 missense probably damaging 1.00
R4619:Tiam2 UTSW 17 3518342 missense probably damaging 1.00
R4715:Tiam2 UTSW 17 3454168 missense probably damaging 1.00
R4723:Tiam2 UTSW 17 3450317 missense probably benign 0.00
R4979:Tiam2 UTSW 17 3505710 missense probably damaging 1.00
R5182:Tiam2 UTSW 17 3438721 missense probably damaging 1.00
R5451:Tiam2 UTSW 17 3428996 missense probably damaging 1.00
R5728:Tiam2 UTSW 17 3414956 missense probably damaging 0.99
R5827:Tiam2 UTSW 17 3448489 missense probably benign 0.00
R5879:Tiam2 UTSW 17 3437265 missense probably damaging 1.00
R5960:Tiam2 UTSW 17 3438640 missense probably benign 0.24
R5974:Tiam2 UTSW 17 3414809 missense possibly damaging 0.51
R6198:Tiam2 UTSW 17 3414121 missense probably benign 0.06
R6222:Tiam2 UTSW 17 3453338 missense probably damaging 0.96
R6295:Tiam2 UTSW 17 3509556 missense probably damaging 1.00
R6355:Tiam2 UTSW 17 3414622 frame shift probably null
R6356:Tiam2 UTSW 17 3414622 frame shift probably null
R6454:Tiam2 UTSW 17 3438663 missense probably benign 0.00
R6497:Tiam2 UTSW 17 3506827 missense probably damaging 1.00
R6579:Tiam2 UTSW 17 3414622 frame shift probably null
R6580:Tiam2 UTSW 17 3414622 frame shift probably null
R6581:Tiam2 UTSW 17 3414622 frame shift probably null
R6582:Tiam2 UTSW 17 3414622 frame shift probably null
R6648:Tiam2 UTSW 17 3506873 missense probably damaging 1.00
R6705:Tiam2 UTSW 17 3518243 missense probably benign 0.01
R6758:Tiam2 UTSW 17 3518403 missense probably benign 0.01
R6836:Tiam2 UTSW 17 3414380 missense probably benign 0.17
R6924:Tiam2 UTSW 17 3507795 missense probably damaging 1.00
R6977:Tiam2 UTSW 17 3518659 missense probably damaging 1.00
R7051:Tiam2 UTSW 17 3448483 missense probably damaging 0.99
R7151:Tiam2 UTSW 17 3448385 missense probably benign 0.36
R7214:Tiam2 UTSW 17 3518412 missense possibly damaging 0.85
R7332:Tiam2 UTSW 17 3453369 missense probably damaging 1.00
R7334:Tiam2 UTSW 17 3503008 missense possibly damaging 0.92
R7414:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R7660:Tiam2 UTSW 17 3482605 start codon destroyed probably null 0.66
R7743:Tiam2 UTSW 17 3518156 missense possibly damaging 0.53
R7755:Tiam2 UTSW 17 3421316 missense probably benign 0.01
R7805:Tiam2 UTSW 17 3509410 missense probably damaging 1.00
R7813:Tiam2 UTSW 17 3437247 missense probably damaging 1.00
X0027:Tiam2 UTSW 17 3414000 start codon destroyed probably null 1.00
X0060:Tiam2 UTSW 17 3450354 intron probably null
X0065:Tiam2 UTSW 17 3505708 missense probably damaging 1.00
Z1088:Tiam2 UTSW 17 3415019 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTTCCCTCAGTGACAGCGAGAAC -3'
(R):5'- GCAAAGCCCCAGACTCCTGTTTATC -3'

Sequencing Primer
(F):5'- ACAAAACCAGCATTGTTAAGGTG -3'
(R):5'- ACTCCTGTTTATCTTAGAGGGAGAC -3'
Posted On2014-04-13