Incidental Mutation 'R1529:Tbc1d24'
ID166500
Institutional Source Beutler Lab
Gene Symbol Tbc1d24
Ensembl Gene ENSMUSG00000036473
Gene NameTBC1 domain family, member 24
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1529 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24175431-24209387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24185979 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 64 (C64R)
Ref Sequence ENSEMBL: ENSMUSP00000144462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040474] [ENSMUST00000097376] [ENSMUST00000167791] [ENSMUST00000168378] [ENSMUST00000168410] [ENSMUST00000171189] [ENSMUST00000201089] [ENSMUST00000201301] [ENSMUST00000201359] [ENSMUST00000201583] [ENSMUST00000201805] [ENSMUST00000201960] [ENSMUST00000202853] [ENSMUST00000202925]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040474
AA Change: C64R

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036458
Gene: ENSMUSG00000036473
AA Change: C64R

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097376
AA Change: C64R

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000094989
Gene: ENSMUSG00000036473
AA Change: C64R

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
TLDc 342 556 7.8e-82 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167791
AA Change: C64R

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127005
Gene: ENSMUSG00000036473
AA Change: C64R

DomainStartEndE-ValueType
TBC 42 259 8.6e-6 SMART
TLDc 342 556 7.6e-82 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168378
AA Change: C64R

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126107
Gene: ENSMUSG00000036473
AA Change: C64R

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168410
AA Change: C64R

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128868
Gene: ENSMUSG00000036473
AA Change: C64R

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171189
AA Change: C64R

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128001
Gene: ENSMUSG00000036473
AA Change: C64R

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000201089
AA Change: C64R

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144250
Gene: ENSMUSG00000036473
AA Change: C64R

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000201301
AA Change: C64R

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143949
Gene: ENSMUSG00000036473
AA Change: C64R

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
TLDc 342 556 7.8e-82 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201359
AA Change: C64R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144026
Gene: ENSMUSG00000036473
AA Change: C64R

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
Blast:TLDc 283 321 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000201583
SMART Domains Protein: ENSMUSP00000144097
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TLDc 1 182 5.2e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201716
Predicted Effect possibly damaging
Transcript: ENSMUST00000201805
AA Change: C64R

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143883
Gene: ENSMUSG00000036473
AA Change: C64R

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
TLDc 342 556 7.8e-82 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000201960
AA Change: C64R

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144208
Gene: ENSMUSG00000036473
AA Change: C64R

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202018
Predicted Effect probably damaging
Transcript: ENSMUST00000202853
AA Change: C64R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144462
Gene: ENSMUSG00000107169
AA Change: C64R

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
Blast:TLDc 283 321 4e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000202925
AA Change: C64R

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144575
Gene: ENSMUSG00000036473
AA Change: C64R

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a conserved domain, referred to as the TBC domain, characteristic of proteins which interact with GTPases. TBC domain proteins may serve as GTPase-activating proteins for a particular group of GTPases, the Rab (Ras-related proteins in brain) small GTPases which are involved in the regulation of membrane trafficking. Mutations in this gene are associated with familial infantile myoclonic epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik G A 17: 47,413,890 S102L probably benign Het
A430105I19Rik T A 2: 118,761,760 probably null Het
Adam11 T C 11: 102,775,113 probably null Het
AI314180 T C 4: 58,832,701 probably null Het
Amd1 A T 10: 40,290,505 M194K probably benign Het
Ap1b1 T G 11: 5,039,547 F793C probably damaging Het
Arfgef3 G A 10: 18,613,222 R1292* probably null Het
Arhgef5 C A 6: 43,279,515 H1186N probably damaging Het
Atad1 A G 19: 32,706,921 F26L probably benign Het
Atg2b C T 12: 105,661,133 V532I probably benign Het
Atp2b4 A G 1: 133,717,988 F943L probably damaging Het
Atp7b G A 8: 22,028,724 L21F possibly damaging Het
Cenpf A T 1: 189,660,038 D532E probably benign Het
Ckmt2 A T 13: 91,861,201 D202E probably benign Het
Crim1 A C 17: 78,367,954 K864T probably benign Het
Ctnnd2 A G 15: 30,887,121 R765G possibly damaging Het
Ddx10 T A 9: 53,117,199 R802* probably null Het
Dnah7b T A 1: 46,177,281 F1152L probably damaging Het
Dsg1c T C 18: 20,282,023 L659P probably damaging Het
Dzank1 A G 2: 144,482,188 F577L probably benign Het
Eci3 T C 13: 34,956,920 D93G probably benign Het
Ep400 C A 5: 110,739,445 V591L probably benign Het
Fam126b A T 1: 58,539,607 D261E probably benign Het
Fgd3 T C 13: 49,266,694 N569S probably benign Het
Ghsr T A 3: 27,372,482 V229E probably damaging Het
Gm8298 T C 3: 59,861,112 I21T probably benign Het
Gna15 T A 10: 81,509,342 I230F probably damaging Het
Gnl2 A G 4: 125,046,306 S324G probably damaging Het
Grid1 T C 14: 35,309,293 V281A probably benign Het
Hebp2 G A 10: 18,545,761 A12V possibly damaging Het
Hfm1 T C 5: 106,853,123 D1254G probably benign Het
Hif3a A C 7: 17,042,639 S459A probably benign Het
Hnrnpl T A 7: 28,813,923 N149K possibly damaging Het
Hoxc10 A T 15: 102,967,200 S115C probably damaging Het
Ifnab T C 4: 88,691,055 D58G possibly damaging Het
Itfg1 T C 8: 85,810,614 T195A probably benign Het
Itpr3 T A 17: 27,105,485 probably null Het
Iws1 A G 18: 32,080,281 D254G probably benign Het
Kl C A 5: 150,988,941 D718E probably benign Het
Lrit2 A G 14: 37,068,827 I154M probably benign Het
Lrp2 T C 2: 69,523,182 D578G probably damaging Het
Lss T G 10: 76,536,289 Y159* probably null Het
Mab21l1 C A 3: 55,783,833 Y280* probably null Het
Maf A T 8: 115,693,170 S378T probably benign Het
Mast2 C T 4: 116,430,519 V59I probably benign Het
Nisch C T 14: 31,180,938 probably benign Het
Nova2 A T 7: 18,957,554 N139Y probably damaging Het
Nup210 C A 6: 91,036,376 D434Y probably damaging Het
Nvl C T 1: 181,109,159 probably null Het
Olfr1049 A T 2: 86,255,241 Y151N probably damaging Het
Olfr1087 A G 2: 86,690,333 V214A possibly damaging Het
Olfr577 A G 7: 102,973,879 Y38H probably damaging Het
Olfr657 A G 7: 104,636,489 T272A probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Pbx3 T C 2: 34,204,859 Y255C probably damaging Het
Pcyt1a G A 16: 32,451,793 E27K possibly damaging Het
Pex6 A T 17: 46,714,064 T348S probably benign Het
Phf21b A G 15: 84,797,396 I251T probably damaging Het
Pkd2l2 T C 18: 34,430,702 I490T probably damaging Het
Pla2g12a T A 3: 129,878,885 L56Q probably damaging Het
Plk4 A G 3: 40,806,536 T434A probably benign Het
Ptpn13 A G 5: 103,564,132 N1632S probably benign Het
Rfpl4 C T 7: 5,110,712 V151M probably damaging Het
Rpain G C 11: 70,974,915 E169Q probably damaging Het
Samd8 T A 14: 21,775,159 V124D possibly damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc12a1 C T 2: 125,190,295 T622I probably damaging Het
Slc17a3 T A 13: 23,845,445 V67D probably damaging Het
Slc41a3 G T 6: 90,644,216 V387L probably damaging Het
Slitrk1 T A 14: 108,913,277 M1L probably benign Het
Stat4 T C 1: 52,011,793 W4R probably damaging Het
Tas2r126 A G 6: 42,434,568 T12A probably benign Het
Tcaf2 T C 6: 42,629,506 S505G probably benign Het
Tiam2 T C 17: 3,516,703 V1506A probably benign Het
Tmem9b A C 7: 109,736,949 S163A probably benign Het
Tmtc2 G A 10: 105,303,658 S669L probably damaging Het
Tnpo3 A T 6: 29,560,221 I641K possibly damaging Het
Ttn C T 2: 76,735,367 A28214T probably damaging Het
Utp11 G A 4: 124,683,239 A113V probably benign Het
Utp20 G A 10: 88,753,006 R2434C probably damaging Het
Vmn1r60 A T 7: 5,544,903 I66N probably benign Het
Zeb2 T C 2: 44,997,194 E572G probably damaging Het
Other mutations in Tbc1d24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Tbc1d24 APN 17 24185828 missense probably damaging 1.00
IGL01511:Tbc1d24 APN 17 24181918 missense probably benign 0.00
IGL02499:Tbc1d24 APN 17 24207619 unclassified probably null
IGL02706:Tbc1d24 APN 17 24185421 missense probably benign 0.32
R1464:Tbc1d24 UTSW 17 24181223 critical splice donor site probably null
R1464:Tbc1d24 UTSW 17 24181223 critical splice donor site probably null
R1985:Tbc1d24 UTSW 17 24207964 nonsense probably null
R1987:Tbc1d24 UTSW 17 24206872 missense possibly damaging 0.94
R2425:Tbc1d24 UTSW 17 24186008 missense probably damaging 0.99
R2902:Tbc1d24 UTSW 17 24207246 missense probably benign 0.01
R4622:Tbc1d24 UTSW 17 24208891 missense probably benign 0.03
R4946:Tbc1d24 UTSW 17 24208536 missense possibly damaging 0.94
R5428:Tbc1d24 UTSW 17 24181772 missense probably benign 0.34
R5890:Tbc1d24 UTSW 17 24185526 missense probably damaging 1.00
R5991:Tbc1d24 UTSW 17 24209069 unclassified probably benign
R6002:Tbc1d24 UTSW 17 24183787 start codon destroyed probably null 1.00
R6145:Tbc1d24 UTSW 17 24208229 missense probably damaging 1.00
R6245:Tbc1d24 UTSW 17 24185993 missense probably damaging 1.00
R6399:Tbc1d24 UTSW 17 24208329 missense probably damaging 0.97
R6764:Tbc1d24 UTSW 17 24185780 missense possibly damaging 0.95
R6893:Tbc1d24 UTSW 17 24182518 missense probably damaging 1.00
R7219:Tbc1d24 UTSW 17 24185292 missense probably damaging 1.00
R7262:Tbc1d24 UTSW 17 24207846 missense probably damaging 1.00
R7490:Tbc1d24 UTSW 17 24182520 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGTGGAAGAACTTGAGGATGGC -3'
(R):5'- CCCCAGGGTACAATTGCTTTGTGG -3'

Sequencing Primer
(F):5'- CCAGGAAGCTCTGGTCAATG -3'
(R):5'- GTACAATTGCTTTGTGGATAAGGAC -3'
Posted On2014-04-13