Incidental Mutation 'R1529:Crim1'
ID 166505
Institutional Source Beutler Lab
Gene Symbol Crim1
Ensembl Gene ENSMUSG00000024074
Gene Name cysteine rich transmembrane BMP regulator 1
Synonyms
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1529 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 78507677-78684021 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 78675383 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Threonine at position 864 (K864T)
Ref Sequence ENSEMBL: ENSMUSP00000108117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112498]
AlphaFold Q9JLL0
Predicted Effect probably benign
Transcript: ENSMUST00000112498
AA Change: K864T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: K864T

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
IB 35 111 1.87e-5 SMART
VWC 336 390 6.04e-13 SMART
VWC 403 456 1.15e-9 SMART
Pfam:Antistasin 469 498 4.5e-10 PFAM
Pfam:Antistasin 505 532 1.5e-8 PFAM
Pfam:Antistasin 539 564 5.7e-9 PFAM
Pfam:Antistasin 567 592 1.7e-10 PFAM
VWC 608 662 1.26e-10 SMART
VWC 679 734 1.37e-11 SMART
VWC 753 808 1.46e-11 SMART
VWC 819 873 1.01e-14 SMART
transmembrane domain 940 962 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm3 T C 3: 59,768,533 (GRCm39) I21T probably benign Het
Adam11 T C 11: 102,665,939 (GRCm39) probably null Het
Amd1 A T 10: 40,166,501 (GRCm39) M194K probably benign Het
Ap1b1 T G 11: 4,989,547 (GRCm39) F793C probably damaging Het
Arfgef3 G A 10: 18,488,970 (GRCm39) R1292* probably null Het
Arhgef5 C A 6: 43,256,449 (GRCm39) H1186N probably damaging Het
Atad1 A G 19: 32,684,321 (GRCm39) F26L probably benign Het
Atg2b C T 12: 105,627,392 (GRCm39) V532I probably benign Het
Atp2b4 A G 1: 133,645,726 (GRCm39) F943L probably damaging Het
Atp7b G A 8: 22,518,740 (GRCm39) L21F possibly damaging Het
Ccdc9b T A 2: 118,592,241 (GRCm39) probably null Het
Cenpf A T 1: 189,392,235 (GRCm39) D532E probably benign Het
Cimip3 G A 17: 47,724,815 (GRCm39) S102L probably benign Het
Ckmt2 A T 13: 92,009,320 (GRCm39) D202E probably benign Het
Ctnnd2 A G 15: 30,887,267 (GRCm39) R765G possibly damaging Het
Ddx10 T A 9: 53,028,499 (GRCm39) R802* probably null Het
Dnah7b T A 1: 46,216,441 (GRCm39) F1152L probably damaging Het
Dsg1c T C 18: 20,415,080 (GRCm39) L659P probably damaging Het
Dzank1 A G 2: 144,324,108 (GRCm39) F577L probably benign Het
Eci3 T C 13: 35,140,903 (GRCm39) D93G probably benign Het
Ecpas T C 4: 58,832,701 (GRCm39) probably null Het
Ep400 C A 5: 110,887,311 (GRCm39) V591L probably benign Het
Fgd3 T C 13: 49,420,170 (GRCm39) N569S probably benign Het
Ghsr T A 3: 27,426,631 (GRCm39) V229E probably damaging Het
Gna15 T A 10: 81,345,176 (GRCm39) I230F probably damaging Het
Gnl2 A G 4: 124,940,099 (GRCm39) S324G probably damaging Het
Grid1 T C 14: 35,031,250 (GRCm39) V281A probably benign Het
Hebp2 G A 10: 18,421,509 (GRCm39) A12V possibly damaging Het
Hfm1 T C 5: 107,000,989 (GRCm39) D1254G probably benign Het
Hif3a A C 7: 16,776,564 (GRCm39) S459A probably benign Het
Hnrnpl T A 7: 28,513,348 (GRCm39) N149K possibly damaging Het
Hoxc10 A T 15: 102,875,635 (GRCm39) S115C probably damaging Het
Hycc2 A T 1: 58,578,766 (GRCm39) D261E probably benign Het
Ifnab T C 4: 88,609,292 (GRCm39) D58G possibly damaging Het
Itfg1 T C 8: 86,537,243 (GRCm39) T195A probably benign Het
Itpr3 T A 17: 27,324,459 (GRCm39) probably null Het
Iws1 A G 18: 32,213,334 (GRCm39) D254G probably benign Het
Kl C A 5: 150,912,406 (GRCm39) D718E probably benign Het
Lrit2 A G 14: 36,790,784 (GRCm39) I154M probably benign Het
Lrp2 T C 2: 69,353,526 (GRCm39) D578G probably damaging Het
Lss T G 10: 76,372,123 (GRCm39) Y159* probably null Het
Mab21l1 C A 3: 55,691,254 (GRCm39) Y280* probably null Het
Maf A T 8: 116,419,909 (GRCm39) S378T probably benign Het
Mast2 C T 4: 116,287,716 (GRCm39) V59I probably benign Het
Nisch C T 14: 30,902,895 (GRCm39) probably benign Het
Nova2 A T 7: 18,691,479 (GRCm39) N139Y probably damaging Het
Nup210 C A 6: 91,013,358 (GRCm39) D434Y probably damaging Het
Nvl C T 1: 180,936,724 (GRCm39) probably null Het
Or11g27 T C 14: 50,771,159 (GRCm39) S97P possibly damaging Het
Or51g2 A G 7: 102,623,086 (GRCm39) Y38H probably damaging Het
Or56b1 A G 7: 104,285,696 (GRCm39) T272A probably benign Het
Or8k18 A T 2: 86,085,585 (GRCm39) Y151N probably damaging Het
Or8k3b A G 2: 86,520,677 (GRCm39) V214A possibly damaging Het
Pbx3 T C 2: 34,094,871 (GRCm39) Y255C probably damaging Het
Pcyt1a G A 16: 32,270,611 (GRCm39) E27K possibly damaging Het
Pex6 A T 17: 47,024,990 (GRCm39) T348S probably benign Het
Phf21b A G 15: 84,681,597 (GRCm39) I251T probably damaging Het
Pkd2l2 T C 18: 34,563,755 (GRCm39) I490T probably damaging Het
Pla2g12a T A 3: 129,672,534 (GRCm39) L56Q probably damaging Het
Plk4 A G 3: 40,760,971 (GRCm39) T434A probably benign Het
Ptpn13 A G 5: 103,711,998 (GRCm39) N1632S probably benign Het
Rfpl4 C T 7: 5,113,711 (GRCm39) V151M probably damaging Het
Rpain G C 11: 70,865,741 (GRCm39) E169Q probably damaging Het
Samd8 T A 14: 21,825,227 (GRCm39) V124D possibly damaging Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Slc12a1 C T 2: 125,032,215 (GRCm39) T622I probably damaging Het
Slc17a3 T A 13: 24,029,428 (GRCm39) V67D probably damaging Het
Slc41a3 G T 6: 90,621,198 (GRCm39) V387L probably damaging Het
Slitrk1 T A 14: 109,150,709 (GRCm39) M1L probably benign Het
Stat4 T C 1: 52,050,952 (GRCm39) W4R probably damaging Het
Tas2r126 A G 6: 42,411,502 (GRCm39) T12A probably benign Het
Tbc1d24 A G 17: 24,404,953 (GRCm39) C64R probably damaging Het
Tcaf2 T C 6: 42,606,440 (GRCm39) S505G probably benign Het
Tiam2 T C 17: 3,566,978 (GRCm39) V1506A probably benign Het
Tmem9b A C 7: 109,336,156 (GRCm39) S163A probably benign Het
Tmtc2 G A 10: 105,139,519 (GRCm39) S669L probably damaging Het
Tnpo3 A T 6: 29,560,220 (GRCm39) I641K possibly damaging Het
Ttn C T 2: 76,565,711 (GRCm39) A28214T probably damaging Het
Utp11 G A 4: 124,577,032 (GRCm39) A113V probably benign Het
Utp20 G A 10: 88,588,868 (GRCm39) R2434C probably damaging Het
Vmn1r60 A T 7: 5,547,902 (GRCm39) I66N probably benign Het
Zeb2 T C 2: 44,887,206 (GRCm39) E572G probably damaging Het
Other mutations in Crim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Crim1 APN 17 78,677,520 (GRCm39) missense probably damaging 1.00
IGL01090:Crim1 APN 17 78,654,658 (GRCm39) missense probably damaging 0.97
IGL01490:Crim1 APN 17 78,642,725 (GRCm39) missense possibly damaging 0.94
IGL01686:Crim1 APN 17 78,651,863 (GRCm39) missense probably benign 0.09
IGL01769:Crim1 APN 17 78,620,664 (GRCm39) missense probably benign 0.02
IGL02004:Crim1 APN 17 78,680,004 (GRCm39) splice site probably benign
IGL02211:Crim1 APN 17 78,662,574 (GRCm39) missense probably damaging 1.00
IGL02275:Crim1 APN 17 78,677,427 (GRCm39) missense possibly damaging 0.56
IGL02408:Crim1 APN 17 78,623,083 (GRCm39) missense possibly damaging 0.78
IGL02411:Crim1 APN 17 78,642,763 (GRCm39) nonsense probably null
IGL02453:Crim1 APN 17 78,651,913 (GRCm39) missense probably damaging 1.00
IGL02481:Crim1 APN 17 78,658,227 (GRCm39) missense probably damaging 0.98
IGL02632:Crim1 APN 17 78,680,103 (GRCm39) missense probably benign 0.08
IGL02652:Crim1 APN 17 78,623,106 (GRCm39) missense probably damaging 1.00
IGL02696:Crim1 APN 17 78,587,402 (GRCm39) missense probably damaging 0.96
IGL02811:Crim1 APN 17 78,658,130 (GRCm39) missense possibly damaging 0.62
IGL03105:Crim1 APN 17 78,623,179 (GRCm39) splice site probably benign
IGL03349:Crim1 APN 17 78,662,579 (GRCm39) nonsense probably null
bugeye UTSW 17 78,588,776 (GRCm39) missense possibly damaging 0.94
IGL03097:Crim1 UTSW 17 78,675,227 (GRCm39) missense probably benign 0.00
R0227:Crim1 UTSW 17 78,651,938 (GRCm39) splice site probably benign
R0458:Crim1 UTSW 17 78,620,655 (GRCm39) missense probably damaging 0.98
R0482:Crim1 UTSW 17 78,680,008 (GRCm39) missense probably benign 0.00
R0989:Crim1 UTSW 17 78,508,373 (GRCm39) missense probably benign 0.21
R1266:Crim1 UTSW 17 78,508,262 (GRCm39) small deletion probably benign
R1679:Crim1 UTSW 17 78,508,228 (GRCm39) missense probably benign 0.27
R1909:Crim1 UTSW 17 78,620,556 (GRCm39) missense probably benign 0.26
R2273:Crim1 UTSW 17 78,662,608 (GRCm39) critical splice donor site probably null
R3899:Crim1 UTSW 17 78,588,783 (GRCm39) missense probably benign 0.00
R3909:Crim1 UTSW 17 78,588,668 (GRCm39) splice site probably benign
R4092:Crim1 UTSW 17 78,658,265 (GRCm39) missense probably damaging 1.00
R4154:Crim1 UTSW 17 78,545,272 (GRCm39) missense probably benign 0.01
R4687:Crim1 UTSW 17 78,610,454 (GRCm39) missense probably damaging 1.00
R5022:Crim1 UTSW 17 78,587,558 (GRCm39) missense possibly damaging 0.95
R5073:Crim1 UTSW 17 78,588,776 (GRCm39) missense possibly damaging 0.94
R5089:Crim1 UTSW 17 78,681,519 (GRCm39) missense probably damaging 1.00
R5284:Crim1 UTSW 17 78,620,695 (GRCm39) missense possibly damaging 0.83
R5461:Crim1 UTSW 17 78,545,236 (GRCm39) missense probably damaging 1.00
R5635:Crim1 UTSW 17 78,623,070 (GRCm39) missense probably damaging 1.00
R5686:Crim1 UTSW 17 78,681,512 (GRCm39) missense possibly damaging 0.63
R5956:Crim1 UTSW 17 78,623,146 (GRCm39) missense probably damaging 1.00
R6117:Crim1 UTSW 17 78,610,517 (GRCm39) missense probably damaging 1.00
R6129:Crim1 UTSW 17 78,588,738 (GRCm39) missense probably benign 0.17
R6265:Crim1 UTSW 17 78,677,514 (GRCm39) missense probably benign 0.01
R6812:Crim1 UTSW 17 78,623,029 (GRCm39) missense probably damaging 1.00
R6858:Crim1 UTSW 17 78,623,056 (GRCm39) missense probably damaging 1.00
R7920:Crim1 UTSW 17 78,610,493 (GRCm39) missense probably damaging 1.00
R8022:Crim1 UTSW 17 78,622,984 (GRCm39) missense possibly damaging 0.82
R8434:Crim1 UTSW 17 78,654,686 (GRCm39) missense probably benign 0.00
R8782:Crim1 UTSW 17 78,508,306 (GRCm39) missense probably damaging 1.00
R8961:Crim1 UTSW 17 78,680,117 (GRCm39) missense possibly damaging 0.65
R8971:Crim1 UTSW 17 78,653,409 (GRCm39) missense possibly damaging 0.89
R9245:Crim1 UTSW 17 78,651,871 (GRCm39) missense probably damaging 1.00
R9250:Crim1 UTSW 17 78,677,471 (GRCm39) missense probably benign
R9401:Crim1 UTSW 17 78,658,294 (GRCm39) frame shift probably null
R9402:Crim1 UTSW 17 78,658,294 (GRCm39) frame shift probably null
R9644:Crim1 UTSW 17 78,587,497 (GRCm39) missense probably damaging 1.00
R9702:Crim1 UTSW 17 78,681,516 (GRCm39) missense probably damaging 1.00
R9710:Crim1 UTSW 17 78,610,504 (GRCm39) nonsense probably null
X0064:Crim1 UTSW 17 78,508,262 (GRCm39) small deletion probably benign
Z1088:Crim1 UTSW 17 78,675,264 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GGAGGAAAATGGTTCCGCCAGATAC -3'
(R):5'- TGGTCACGGCTCTGCAAATTATCCC -3'

Sequencing Primer
(F):5'- GTGCCCCTTAGTATCCTAGTAGAAG -3'
(R):5'- GCAAATTATCCCGAGGACTTTGTG -3'
Posted On 2014-04-13