Incidental Mutation 'R1530:Tgfbr1'
ID166531
Institutional Source Beutler Lab
Gene Symbol Tgfbr1
Ensembl Gene ENSMUSG00000007613
Gene Nametransforming growth factor, beta receptor I
SynonymsTbetaRI, ALK5, TbetaR-I, Alk-5
MMRRC Submission 039569-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1530 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location47353222-47414931 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 47410688 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 406 (W406R)
Ref Sequence ENSEMBL: ENSMUSP00000123761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007757] [ENSMUST00000044234] [ENSMUST00000107725] [ENSMUST00000126171]
Predicted Effect probably damaging
Transcript: ENSMUST00000007757
AA Change: W475R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007757
Gene: ENSMUSG00000007613
AA Change: W475R

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 13 24 N/A INTRINSIC
Pfam:Activin_recp 30 110 2.7e-16 PFAM
transmembrane domain 126 148 N/A INTRINSIC
GS 175 205 1.01e-14 SMART
Blast:STYKc 207 492 7e-31 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000044234
AA Change: W471R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048501
Gene: ENSMUSG00000007613
AA Change: W471R

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 13 24 N/A INTRINSIC
Pfam:Activin_recp 30 110 1.6e-14 PFAM
transmembrane domain 122 144 N/A INTRINSIC
GS 171 201 1.01e-14 SMART
Blast:STYKc 203 488 8e-31 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000107725
AA Change: W392R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103353
Gene: ENSMUSG00000007613
AA Change: W392R

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
GS 92 122 1.01e-14 SMART
Blast:STYKc 124 409 3e-31 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000126171
AA Change: W406R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123761
Gene: ENSMUSG00000007613
AA Change: W406R

DomainStartEndE-ValueType
PDB:3KFD|L 1 45 3e-26 PDB
transmembrane domain 57 79 N/A INTRINSIC
GS 106 136 1.01e-14 SMART
Blast:STYKc 138 423 3e-31 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the transforming growth factor beta (TGF-beta) receptor family of proteins. These proteins comprise one component of the TGF-beta signaling pathway, which transduces extracellular signals into gene expression changes to regulate a wide range of cellular responses, including proliferation, migration, differentiation and apoptosis. Homozygous knockout mice for this gene exhibit impaired angiogenesis and embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for some targeted null mutations exhibit defects of the yolk sac and placenta, lack circulating erythrocytes, and die at midgestation. Mutant endothelial cells show enhanced proliferation, improper migration, and reduced fibronectin production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b T C 5: 137,569,378 C425R probably damaging Het
Adam15 A G 3: 89,349,830 S20P probably damaging Het
Adgra3 G A 5: 49,961,137 T1023I probably benign Het
Angel2 T A 1: 190,939,088 V46E probably damaging Het
Ankrd13c T A 3: 157,991,721 M321K probably damaging Het
Atad2b C T 12: 4,942,018 R206* probably null Het
Atp10b T A 11: 43,197,524 F319Y probably benign Het
AW554918 A G 18: 25,400,104 R272G probably damaging Het
BC027072 A G 17: 71,749,478 V1068A probably benign Het
Bpi T A 2: 158,261,145 I70N probably damaging Het
Brca1 T C 11: 101,524,695 D871G probably damaging Het
Capn3 G A 2: 120,482,208 A160T probably damaging Het
Cenpe T C 3: 135,246,902 L1451P possibly damaging Het
Chmp7 A G 14: 69,732,488 M1T probably null Het
Csrnp1 G C 9: 119,973,546 Q200E possibly damaging Het
Dscam G A 16: 96,819,874 P545S probably damaging Het
Erap1 A G 13: 74,646,543 E107G probably benign Het
Errfi1 A G 4: 150,865,386 I49V probably benign Het
Fam160b1 T A 19: 57,386,305 I704N probably damaging Het
Fam171b T C 2: 83,880,189 L735S probably damaging Het
Fancm T A 12: 65,092,490 probably null Het
Fbp2 G C 13: 62,837,159 P316R probably damaging Het
Fcer2a C A 8: 3,682,976 G255V probably damaging Het
Fzd2 T C 11: 102,605,308 S193P probably benign Het
Gak A G 5: 108,624,193 V86A probably damaging Het
Gas2l3 A G 10: 89,433,769 I7T probably benign Het
Gbp11 T C 5: 105,327,489 H331R probably damaging Het
Gpr19 C T 6: 134,869,998 V241M probably damaging Het
Grk6 G A 13: 55,458,799 A437T probably damaging Het
Hip1 T C 5: 135,444,780 D253G probably damaging Het
Ifna9 G C 4: 88,592,172 Q72E possibly damaging Het
Il1r1 A G 1: 40,312,361 T384A probably benign Het
Ip6k1 C A 9: 108,045,562 C221* probably null Het
Kcna1 C A 6: 126,642,531 E275D probably benign Het
Kcnt2 C T 1: 140,484,232 Q468* probably null Het
Kin T C 2: 10,092,339 V333A probably damaging Het
Leprot G T 4: 101,656,287 V91L probably benign Het
Mettl21c A G 1: 44,017,184 probably null Het
Myom2 T C 8: 15,122,384 F1161S probably damaging Het
Ndor1 A G 2: 25,248,909 L321P probably benign Het
Nipal2 A T 15: 34,625,022 *72K probably null Het
Nol3 T C 8: 105,279,226 V84A probably benign Het
Olfr1188 A T 2: 88,559,483 I5F probably benign Het
Olfr1388 C T 11: 49,443,905 S18L probably benign Het
Olfr901 T C 9: 38,430,324 I14T probably damaging Het
Pdgfra T A 5: 75,189,010 probably null Het
Pik3cb T C 9: 99,053,973 D802G probably damaging Het
Plac8l1 A T 18: 42,178,931 V141E probably damaging Het
Plxnb2 A G 15: 89,167,192 S275P probably benign Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rapgef6 T A 11: 54,661,183 I959K probably damaging Het
Scn5a T C 9: 119,495,562 K1400R probably damaging Het
Sel1l A G 12: 91,826,684 S263P probably damaging Het
Setd5 G A 6: 113,109,913 V34I probably damaging Het
Slc17a2 A G 13: 23,819,069 D234G probably damaging Het
Spink5 T A 18: 44,015,671 S934T probably damaging Het
St18 A C 1: 6,845,569 probably null Het
St3gal4 T C 9: 35,052,296 I239V probably benign Het
Stag3 C T 5: 138,297,412 T399I probably damaging Het
Syt11 T C 3: 88,762,367 K6E probably damaging Het
Taf15 T C 11: 83,487,296 Y121H possibly damaging Het
Tdh T C 14: 63,496,055 Y113C probably damaging Het
Tgm6 A G 2: 130,151,282 I563V possibly damaging Het
Tmem131 A G 1: 36,827,009 probably null Het
Tmub2 T C 11: 102,287,486 S72P probably benign Het
Trappc13 G A 13: 104,150,143 T202I probably damaging Het
Trim9 T C 12: 70,272,428 E449G probably damaging Het
Trip11 C A 12: 101,912,767 G21V unknown Het
Ttll12 G A 15: 83,588,655 R127C probably damaging Het
Vmn2r125 A T 4: 156,351,152 Y275F probably damaging Het
Xrcc5 A G 1: 72,329,944 D319G probably damaging Het
Zc3h14 T G 12: 98,785,003 C159W probably damaging Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfhx3 C T 8: 108,948,489 P2057L probably damaging Het
Other mutations in Tgfbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Tgfbr1 APN 4 47383992 missense probably benign 0.00
IGL00757:Tgfbr1 APN 4 47405581 missense probably damaging 1.00
IGL02001:Tgfbr1 APN 4 47403388 missense probably damaging 1.00
IGL02207:Tgfbr1 APN 4 47410785 utr 3 prime probably benign
IGL02338:Tgfbr1 APN 4 47393490 critical splice donor site probably null
PIT4480001:Tgfbr1 UTSW 4 47402955 missense probably benign 0.44
R0097:Tgfbr1 UTSW 4 47403451 nonsense probably null
R0097:Tgfbr1 UTSW 4 47403451 nonsense probably null
R1299:Tgfbr1 UTSW 4 47396587 critical splice donor site probably null
R1444:Tgfbr1 UTSW 4 47393259 missense probably benign
R1591:Tgfbr1 UTSW 4 47403471 missense probably damaging 1.00
R1611:Tgfbr1 UTSW 4 47396526 missense probably damaging 1.00
R2327:Tgfbr1 UTSW 4 47402833 missense probably damaging 1.00
R4352:Tgfbr1 UTSW 4 47402863 missense probably damaging 1.00
R4736:Tgfbr1 UTSW 4 47383835 missense probably benign
R5180:Tgfbr1 UTSW 4 47383948 nonsense probably null
R5907:Tgfbr1 UTSW 4 47396555 missense probably damaging 1.00
R6462:Tgfbr1 UTSW 4 47402846 missense probably damaging 1.00
R6842:Tgfbr1 UTSW 4 47383757 missense probably damaging 1.00
R7017:Tgfbr1 UTSW 4 47410728 missense probably damaging 0.99
R7206:Tgfbr1 UTSW 4 47402941 missense probably damaging 1.00
R7402:Tgfbr1 UTSW 4 47405623 missense probably damaging 1.00
R7862:Tgfbr1 UTSW 4 47403489 missense probably damaging 0.99
R7945:Tgfbr1 UTSW 4 47403489 missense probably damaging 0.99
RF013:Tgfbr1 UTSW 4 47353354 missense unknown
Z1176:Tgfbr1 UTSW 4 47353790 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGTGCAGTTATGTTTGGACCCAGTG -3'
(R):5'- TCTCAGTGAGGTAGAACAACCAGCC -3'

Sequencing Primer
(F):5'- AGTGTCTCGCGTGCCATAG -3'
(R):5'- CTCCTAAACACCCAGGAGCAG -3'
Posted On2014-04-13