Incidental Mutation 'R1530:Actl6b'
Institutional Source Beutler Lab
Gene Symbol Actl6b
Ensembl Gene ENSMUSG00000029712
Gene Nameactin-like 6B
SynonymsActl6, ArpNa, Baf53b
MMRRC Submission 039569-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock #R1530 (G1)
Quality Score225
Status Not validated
Chromosomal Location137553517-137569582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137569378 bp
Amino Acid Change Cysteine to Arginine at position 425 (C425R)
Ref Sequence ENSEMBL: ENSMUSP00000119356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031725] [ENSMUST00000031729] [ENSMUST00000136565] [ENSMUST00000139395] [ENSMUST00000196471] [ENSMUST00000198601] [ENSMUST00000198783] [ENSMUST00000198866] [ENSMUST00000199054]
Predicted Effect probably benign
Transcript: ENSMUST00000031725
SMART Domains Protein: ENSMUSP00000031725
Gene: ENSMUSG00000029712

ACTIN 11 379 4.16e-116 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000031729
SMART Domains Protein: ENSMUSP00000031729
Gene: ENSMUSG00000029716

low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 235 326 2.2e-12 PFAM
Pfam:Peptidase_M28 407 618 2.9e-16 PFAM
Pfam:TFR_dimer 664 788 5.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136565
SMART Domains Protein: ENSMUSP00000117425
Gene: ENSMUSG00000029712

Pfam:Actin 1 116 1.3e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139395
AA Change: C425R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119356
Gene: ENSMUSG00000029712
AA Change: C425R

ACTIN 11 426 5.96e-167 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196471
SMART Domains Protein: ENSMUSP00000142814
Gene: ENSMUSG00000029716

low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198601
Predicted Effect probably benign
Transcript: ENSMUST00000198783
SMART Domains Protein: ENSMUSP00000142502
Gene: ENSMUSG00000029716

low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198866
SMART Domains Protein: ENSMUSP00000142720
Gene: ENSMUSG00000029716

low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199054
SMART Domains Protein: ENSMUSP00000142478
Gene: ENSMUSG00000029716

low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200190
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of actin-related proteins (ARPs) which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene encodes a subunit of the BAF (BRG1/brm-associated factor) complex in mammals, which is functionally related to SWI/SNF complex in S. cerevisiae and Drosophila; the latter is thought to facilitate transcriptional activation of specific genes by antagonizing chromatin-mediated transcriptional repression. This subunit may be involved in the regulation of genes by structural modulation of their chromatin, specifically in the brain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for null mutations exhibit low survivor rate and most die within 2 days after birth and show hyperactivity due to reduced dendrite formation in neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 A G 3: 89,349,830 S20P probably damaging Het
Adgra3 G A 5: 49,961,137 T1023I probably benign Het
Angel2 T A 1: 190,939,088 V46E probably damaging Het
Ankrd13c T A 3: 157,991,721 M321K probably damaging Het
Atad2b C T 12: 4,942,018 R206* probably null Het
Atp10b T A 11: 43,197,524 F319Y probably benign Het
AW554918 A G 18: 25,400,104 R272G probably damaging Het
BC027072 A G 17: 71,749,478 V1068A probably benign Het
Bpi T A 2: 158,261,145 I70N probably damaging Het
Brca1 T C 11: 101,524,695 D871G probably damaging Het
Capn3 G A 2: 120,482,208 A160T probably damaging Het
Cenpe T C 3: 135,246,902 L1451P possibly damaging Het
Chmp7 A G 14: 69,732,488 M1T probably null Het
Csrnp1 G C 9: 119,973,546 Q200E possibly damaging Het
Dscam G A 16: 96,819,874 P545S probably damaging Het
Erap1 A G 13: 74,646,543 E107G probably benign Het
Errfi1 A G 4: 150,865,386 I49V probably benign Het
Fam160b1 T A 19: 57,386,305 I704N probably damaging Het
Fam171b T C 2: 83,880,189 L735S probably damaging Het
Fancm T A 12: 65,092,490 probably null Het
Fbp2 G C 13: 62,837,159 P316R probably damaging Het
Fcer2a C A 8: 3,682,976 G255V probably damaging Het
Fzd2 T C 11: 102,605,308 S193P probably benign Het
Gak A G 5: 108,624,193 V86A probably damaging Het
Gas2l3 A G 10: 89,433,769 I7T probably benign Het
Gbp11 T C 5: 105,327,489 H331R probably damaging Het
Gpr19 C T 6: 134,869,998 V241M probably damaging Het
Grk6 G A 13: 55,458,799 A437T probably damaging Het
Hip1 T C 5: 135,444,780 D253G probably damaging Het
Ifna9 G C 4: 88,592,172 Q72E possibly damaging Het
Il1r1 A G 1: 40,312,361 T384A probably benign Het
Ip6k1 C A 9: 108,045,562 C221* probably null Het
Kcna1 C A 6: 126,642,531 E275D probably benign Het
Kcnt2 C T 1: 140,484,232 Q468* probably null Het
Kin T C 2: 10,092,339 V333A probably damaging Het
Leprot G T 4: 101,656,287 V91L probably benign Het
Mettl21c A G 1: 44,017,184 probably null Het
Myom2 T C 8: 15,122,384 F1161S probably damaging Het
Ndor1 A G 2: 25,248,909 L321P probably benign Het
Nipal2 A T 15: 34,625,022 *72K probably null Het
Nol3 T C 8: 105,279,226 V84A probably benign Het
Olfr1188 A T 2: 88,559,483 I5F probably benign Het
Olfr1388 C T 11: 49,443,905 S18L probably benign Het
Olfr901 T C 9: 38,430,324 I14T probably damaging Het
Pdgfra T A 5: 75,189,010 probably null Het
Pik3cb T C 9: 99,053,973 D802G probably damaging Het
Plac8l1 A T 18: 42,178,931 V141E probably damaging Het
Plxnb2 A G 15: 89,167,192 S275P probably benign Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rapgef6 T A 11: 54,661,183 I959K probably damaging Het
Scn5a T C 9: 119,495,562 K1400R probably damaging Het
Sel1l A G 12: 91,826,684 S263P probably damaging Het
Setd5 G A 6: 113,109,913 V34I probably damaging Het
Slc17a2 A G 13: 23,819,069 D234G probably damaging Het
Spink5 T A 18: 44,015,671 S934T probably damaging Het
St18 A C 1: 6,845,569 probably null Het
St3gal4 T C 9: 35,052,296 I239V probably benign Het
Stag3 C T 5: 138,297,412 T399I probably damaging Het
Syt11 T C 3: 88,762,367 K6E probably damaging Het
Taf15 T C 11: 83,487,296 Y121H possibly damaging Het
Tdh T C 14: 63,496,055 Y113C probably damaging Het
Tgfbr1 T A 4: 47,410,688 W406R probably damaging Het
Tgm6 A G 2: 130,151,282 I563V possibly damaging Het
Tmem131 A G 1: 36,827,009 probably null Het
Tmub2 T C 11: 102,287,486 S72P probably benign Het
Trappc13 G A 13: 104,150,143 T202I probably damaging Het
Trim9 T C 12: 70,272,428 E449G probably damaging Het
Trip11 C A 12: 101,912,767 G21V unknown Het
Ttll12 G A 15: 83,588,655 R127C probably damaging Het
Vmn2r125 A T 4: 156,351,152 Y275F probably damaging Het
Xrcc5 A G 1: 72,329,944 D319G probably damaging Het
Zc3h14 T G 12: 98,785,003 C159W probably damaging Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfhx3 C T 8: 108,948,489 P2057L probably damaging Het
Other mutations in Actl6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Actl6b APN 5 137554637 missense probably damaging 0.99
IGL03271:Actl6b APN 5 137565984 missense probably damaging 1.00
R0128:Actl6b UTSW 5 137555065 missense probably benign
R0254:Actl6b UTSW 5 137554144 intron probably benign
R0571:Actl6b UTSW 5 137566784 unclassified probably benign
R1438:Actl6b UTSW 5 137554609 missense probably damaging 0.99
R1621:Actl6b UTSW 5 137565779 missense probably benign 0.18
R2008:Actl6b UTSW 5 137569330 missense probably damaging 1.00
R2907:Actl6b UTSW 5 137567297 missense probably damaging 1.00
R3826:Actl6b UTSW 5 137567273 missense probably damaging 0.99
R5326:Actl6b UTSW 5 137567051 missense probably damaging 1.00
R5763:Actl6b UTSW 5 137566801 missense possibly damaging 0.49
R5906:Actl6b UTSW 5 137567329 missense possibly damaging 0.95
R5972:Actl6b UTSW 5 137566556 missense possibly damaging 0.55
R6709:Actl6b UTSW 5 137554517 missense possibly damaging 0.91
R7134:Actl6b UTSW 5 137564500 missense probably damaging 0.96
R7249:Actl6b UTSW 5 137555085 missense probably damaging 0.99
X0065:Actl6b UTSW 5 137565737 missense possibly damaging 0.82
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- agagcagcctaaaatctccc -3'
Posted On2014-04-13