Incidental Mutation 'R1530:Ip6k1'
ID166556
Institutional Source Beutler Lab
Gene Symbol Ip6k1
Ensembl Gene ENSMUSG00000032594
Gene Nameinositol hexaphosphate kinase 1
Synonyms1200016D08Rik, InsP6, Ihpk1, InsP6k1
MMRRC Submission 039569-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.458) question?
Stock #R1530 (G1)
Quality Score184
Status Not validated
Chromosome9
Chromosomal Location108002501-108048782 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 108045562 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 221 (C221*)
Ref Sequence ENSEMBL: ENSMUSP00000134754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035214] [ENSMUST00000047947] [ENSMUST00000112295] [ENSMUST00000164395] [ENSMUST00000175874] [ENSMUST00000176566] [ENSMUST00000177158]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035214
AA Change: H298N

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035214
Gene: ENSMUSG00000032594
AA Change: H298N

DomainStartEndE-ValueType
low complexity region 114 129 N/A INTRINSIC
Pfam:IPK 207 426 2.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047947
SMART Domains Protein: ENSMUSP00000036898
Gene: ENSMUSG00000070284

DomainStartEndE-ValueType
Pfam:NTP_transferase 2 234 8e-48 PFAM
Pfam:NTP_transf_3 3 202 6.6e-12 PFAM
Pfam:Hexapep 259 294 1.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112295
SMART Domains Protein: ENSMUSP00000107914
Gene: ENSMUSG00000070284

DomainStartEndE-ValueType
Pfam:NTP_transferase 2 235 2.1e-51 PFAM
Pfam:NTP_transf_3 3 199 1.1e-11 PFAM
Pfam:Hexapep 259 294 9.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150700
Predicted Effect probably benign
Transcript: ENSMUST00000164395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167159
Predicted Effect probably benign
Transcript: ENSMUST00000175874
SMART Domains Protein: ENSMUSP00000135747
Gene: ENSMUSG00000032594

DomainStartEndE-ValueType
low complexity region 114 129 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176454
Predicted Effect probably benign
Transcript: ENSMUST00000176566
Predicted Effect probably benign
Transcript: ENSMUST00000176613
Predicted Effect probably null
Transcript: ENSMUST00000177158
AA Change: C221*
SMART Domains Protein: ENSMUSP00000134754
Gene: ENSMUSG00000032594
AA Change: C221*

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Pfam:IPK 108 206 1.5e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177396
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inositol phosphokinase family. The encoded protein may be responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutation of this gene results in impaired glucose tolerance, decreased insulin levels, bilateral epididymal aspermia, and testicular degeneration in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b T C 5: 137,569,378 C425R probably damaging Het
Adam15 A G 3: 89,349,830 S20P probably damaging Het
Adgra3 G A 5: 49,961,137 T1023I probably benign Het
Angel2 T A 1: 190,939,088 V46E probably damaging Het
Ankrd13c T A 3: 157,991,721 M321K probably damaging Het
Atad2b C T 12: 4,942,018 R206* probably null Het
Atp10b T A 11: 43,197,524 F319Y probably benign Het
AW554918 A G 18: 25,400,104 R272G probably damaging Het
BC027072 A G 17: 71,749,478 V1068A probably benign Het
Bpi T A 2: 158,261,145 I70N probably damaging Het
Brca1 T C 11: 101,524,695 D871G probably damaging Het
Capn3 G A 2: 120,482,208 A160T probably damaging Het
Cenpe T C 3: 135,246,902 L1451P possibly damaging Het
Chmp7 A G 14: 69,732,488 M1T probably null Het
Csrnp1 G C 9: 119,973,546 Q200E possibly damaging Het
Dscam G A 16: 96,819,874 P545S probably damaging Het
Erap1 A G 13: 74,646,543 E107G probably benign Het
Errfi1 A G 4: 150,865,386 I49V probably benign Het
Fam160b1 T A 19: 57,386,305 I704N probably damaging Het
Fam171b T C 2: 83,880,189 L735S probably damaging Het
Fancm T A 12: 65,092,490 probably null Het
Fbp2 G C 13: 62,837,159 P316R probably damaging Het
Fcer2a C A 8: 3,682,976 G255V probably damaging Het
Fzd2 T C 11: 102,605,308 S193P probably benign Het
Gak A G 5: 108,624,193 V86A probably damaging Het
Gas2l3 A G 10: 89,433,769 I7T probably benign Het
Gbp11 T C 5: 105,327,489 H331R probably damaging Het
Gpr19 C T 6: 134,869,998 V241M probably damaging Het
Grk6 G A 13: 55,458,799 A437T probably damaging Het
Hip1 T C 5: 135,444,780 D253G probably damaging Het
Ifna9 G C 4: 88,592,172 Q72E possibly damaging Het
Il1r1 A G 1: 40,312,361 T384A probably benign Het
Kcna1 C A 6: 126,642,531 E275D probably benign Het
Kcnt2 C T 1: 140,484,232 Q468* probably null Het
Kin T C 2: 10,092,339 V333A probably damaging Het
Leprot G T 4: 101,656,287 V91L probably benign Het
Mettl21c A G 1: 44,017,184 probably null Het
Myom2 T C 8: 15,122,384 F1161S probably damaging Het
Ndor1 A G 2: 25,248,909 L321P probably benign Het
Nipal2 A T 15: 34,625,022 *72K probably null Het
Nol3 T C 8: 105,279,226 V84A probably benign Het
Olfr1188 A T 2: 88,559,483 I5F probably benign Het
Olfr1388 C T 11: 49,443,905 S18L probably benign Het
Olfr901 T C 9: 38,430,324 I14T probably damaging Het
Pdgfra T A 5: 75,189,010 probably null Het
Pik3cb T C 9: 99,053,973 D802G probably damaging Het
Plac8l1 A T 18: 42,178,931 V141E probably damaging Het
Plxnb2 A G 15: 89,167,192 S275P probably benign Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rapgef6 T A 11: 54,661,183 I959K probably damaging Het
Scn5a T C 9: 119,495,562 K1400R probably damaging Het
Sel1l A G 12: 91,826,684 S263P probably damaging Het
Setd5 G A 6: 113,109,913 V34I probably damaging Het
Slc17a2 A G 13: 23,819,069 D234G probably damaging Het
Spink5 T A 18: 44,015,671 S934T probably damaging Het
St18 A C 1: 6,845,569 probably null Het
St3gal4 T C 9: 35,052,296 I239V probably benign Het
Stag3 C T 5: 138,297,412 T399I probably damaging Het
Syt11 T C 3: 88,762,367 K6E probably damaging Het
Taf15 T C 11: 83,487,296 Y121H possibly damaging Het
Tdh T C 14: 63,496,055 Y113C probably damaging Het
Tgfbr1 T A 4: 47,410,688 W406R probably damaging Het
Tgm6 A G 2: 130,151,282 I563V possibly damaging Het
Tmem131 A G 1: 36,827,009 probably null Het
Tmub2 T C 11: 102,287,486 S72P probably benign Het
Trappc13 G A 13: 104,150,143 T202I probably damaging Het
Trim9 T C 12: 70,272,428 E449G probably damaging Het
Trip11 C A 12: 101,912,767 G21V unknown Het
Ttll12 G A 15: 83,588,655 R127C probably damaging Het
Vmn2r125 A T 4: 156,351,152 Y275F probably damaging Het
Xrcc5 A G 1: 72,329,944 D319G probably damaging Het
Zc3h14 T G 12: 98,785,003 C159W probably damaging Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfhx3 C T 8: 108,948,489 P2057L probably damaging Het
Other mutations in Ip6k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Ip6k1 APN 9 108045883 missense probably benign 0.01
R0147:Ip6k1 UTSW 9 108045894 missense probably damaging 1.00
R1371:Ip6k1 UTSW 9 108045823 missense probably damaging 0.96
R1716:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1717:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1718:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1719:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1741:Ip6k1 UTSW 9 108040984 missense probably benign 0.43
R1745:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1747:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1901:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1902:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1903:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1962:Ip6k1 UTSW 9 108041088 critical splice donor site probably null
R2126:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R3809:Ip6k1 UTSW 9 108045887 missense probably damaging 1.00
R5000:Ip6k1 UTSW 9 108045599 nonsense probably null
R6074:Ip6k1 UTSW 9 108024109 utr 5 prime probably benign
R6921:Ip6k1 UTSW 9 108024435 missense probably damaging 1.00
R7069:Ip6k1 UTSW 9 108045452 splice site probably null
R7154:Ip6k1 UTSW 9 108045662 missense probably damaging 1.00
R7218:Ip6k1 UTSW 9 108045582 missense unknown
R7330:Ip6k1 UTSW 9 108045253 missense possibly damaging 0.56
R7731:Ip6k1 UTSW 9 108044728 missense probably damaging 1.00
X0021:Ip6k1 UTSW 9 108032190 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTGTTGGCTTTCACAGCTCC -3'
(R):5'- ACGTGCTTGAGACGTAGCTCAGAC -3'

Sequencing Primer
(F):5'- TCAGAGTGCCTTCCAGATTG -3'
(R):5'- TAGCTCAGACCGGCACTC -3'
Posted On2014-04-13