Mutagenetix > Incidental Mutation

Incidental Mutation 'R1530:Rapgef6'

166564

Institutional Source

Beutler Lab

Gene Symbol

Rapgef6

Ensembl Gene

ENSMUSG00000037533

Gene Name

Rap guanine nucleotide exchange factor (GEF) 6

Synonyms

PDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2

MMRRC Submission

039569-MU

Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1530 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

54522847-54699285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 54661183 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 959 (I959K)

Ref Sequence

ENSEMBL: ENSMUSP00000147135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000207429]

AlphaFold

Q5NCJ1

Predicted Effect

probably damaging
Transcript: ENSMUST00000094536
AA Change: I669K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533
AA Change: I669K

Domain	Start	End	E-Value	Type
cNMP	1	113	6.64e-7	SMART
RasGEFN	127	240	4.35e-33	SMART
PDZ	255	327	8.86e-16	SMART
low complexity region	409	420	N/A	INTRINSIC
RA	464	550	1.47e-20	SMART
RasGEF	571	853	3.88e-84	SMART
low complexity region	944	957	N/A	INTRINSIC
low complexity region	972	989	N/A	INTRINSIC
low complexity region	1016	1061	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000101206
AA Change: I954K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: I954K

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.45e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1095	5.35e-87	SMART
low complexity region	1237	1250	N/A	INTRINSIC
low complexity region	1270	1293	N/A	INTRINSIC
low complexity region	1345	1364	N/A	INTRINSIC
low complexity region	1368	1380	N/A	INTRINSIC
low complexity region	1444	1452	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1591	1604	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102743
AA Change: I954K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: I954K

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.42e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1138	3.88e-84	SMART
low complexity region	1229	1242	N/A	INTRINSIC
low complexity region	1262	1285	N/A	INTRINSIC
low complexity region	1337	1356	N/A	INTRINSIC
low complexity region	1360	1372	N/A	INTRINSIC
low complexity region	1436	1444	N/A	INTRINSIC
low complexity region	1547	1560	N/A	INTRINSIC
low complexity region	1583	1596	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108894
AA Change: I669K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533
AA Change: I669K

Domain	Start	End	E-Value	Type
cNMP	1	113	6.64e-7	SMART
RasGEFN	127	240	4.35e-33	SMART
PDZ	255	327	8.86e-16	SMART
low complexity region	409	420	N/A	INTRINSIC
RA	464	550	1.47e-20	SMART
RasGEF	571	810	5.35e-87	SMART
low complexity region	952	965	N/A	INTRINSIC
low complexity region	980	997	N/A	INTRINSIC
low complexity region	1024	1069	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175600

Predicted Effect

probably damaging
Transcript: ENSMUST00000207429
AA Change: I959K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl6b	T	C	5: 137,569,378	C425R	probably damaging	Het
Adam15	A	G	3: 89,349,830	S20P	probably damaging	Het
Adgra3	G	A	5: 49,961,137	T1023I	probably benign	Het
Angel2	T	A	1: 190,939,088	V46E	probably damaging	Het
Ankrd13c	T	A	3: 157,991,721	M321K	probably damaging	Het
Atad2b	C	T	12: 4,942,018	R206*	probably null	Het
Atp10b	T	A	11: 43,197,524	F319Y	probably benign	Het
AW554918	A	G	18: 25,400,104	R272G	probably damaging	Het
BC027072	A	G	17: 71,749,478	V1068A	probably benign	Het
Bpi	T	A	2: 158,261,145	I70N	probably damaging	Het
Brca1	T	C	11: 101,524,695	D871G	probably damaging	Het
Capn3	G	A	2: 120,482,208	A160T	probably damaging	Het
Cenpe	T	C	3: 135,246,902	L1451P	possibly damaging	Het
Chmp7	A	G	14: 69,732,488	M1T	probably null	Het
Csrnp1	G	C	9: 119,973,546	Q200E	possibly damaging	Het
Dscam	G	A	16: 96,819,874	P545S	probably damaging	Het
Erap1	A	G	13: 74,646,543	E107G	probably benign	Het
Errfi1	A	G	4: 150,865,386	I49V	probably benign	Het
Fam160b1	T	A	19: 57,386,305	I704N	probably damaging	Het
Fam171b	T	C	2: 83,880,189	L735S	probably damaging	Het
Fancm	T	A	12: 65,092,490		probably null	Het
Fbp2	G	C	13: 62,837,159	P316R	probably damaging	Het
Fcer2a	C	A	8: 3,682,976	G255V	probably damaging	Het
Fzd2	T	C	11: 102,605,308	S193P	probably benign	Het
Gak	A	G	5: 108,624,193	V86A	probably damaging	Het
Gas2l3	A	G	10: 89,433,769	I7T	probably benign	Het
Gbp11	T	C	5: 105,327,489	H331R	probably damaging	Het
Gpr19	C	T	6: 134,869,998	V241M	probably damaging	Het
Grk6	G	A	13: 55,458,799	A437T	probably damaging	Het
Hip1	T	C	5: 135,444,780	D253G	probably damaging	Het
Ifna9	G	C	4: 88,592,172	Q72E	possibly damaging	Het
Il1r1	A	G	1: 40,312,361	T384A	probably benign	Het
Ip6k1	C	A	9: 108,045,562	C221*	probably null	Het
Kcna1	C	A	6: 126,642,531	E275D	probably benign	Het
Kcnt2	C	T	1: 140,484,232	Q468*	probably null	Het
Kin	T	C	2: 10,092,339	V333A	probably damaging	Het
Leprot	G	T	4: 101,656,287	V91L	probably benign	Het
Mettl21c	A	G	1: 44,017,184		probably null	Het
Myom2	T	C	8: 15,122,384	F1161S	probably damaging	Het
Ndor1	A	G	2: 25,248,909	L321P	probably benign	Het
Nipal2	A	T	15: 34,625,022	*72K	probably null	Het
Nol3	T	C	8: 105,279,226	V84A	probably benign	Het
Olfr1188	A	T	2: 88,559,483	I5F	probably benign	Het
Olfr1388	C	T	11: 49,443,905	S18L	probably benign	Het
Olfr901	T	C	9: 38,430,324	I14T	probably damaging	Het
Pdgfra	T	A	5: 75,189,010		probably null	Het
Pik3cb	T	C	9: 99,053,973	D802G	probably damaging	Het
Plac8l1	A	T	18: 42,178,931	V141E	probably damaging	Het
Plxnb2	A	G	15: 89,167,192	S275P	probably benign	Het
Prl3b1	G	A	13: 27,243,865	A53T	probably benign	Het
Scn5a	T	C	9: 119,495,562	K1400R	probably damaging	Het
Sel1l	A	G	12: 91,826,684	S263P	probably damaging	Het
Setd5	G	A	6: 113,109,913	V34I	probably damaging	Het
Slc17a2	A	G	13: 23,819,069	D234G	probably damaging	Het
Spink5	T	A	18: 44,015,671	S934T	probably damaging	Het
St18	A	C	1: 6,845,569		probably null	Het
St3gal4	T	C	9: 35,052,296	I239V	probably benign	Het
Stag3	C	T	5: 138,297,412	T399I	probably damaging	Het
Syt11	T	C	3: 88,762,367	K6E	probably damaging	Het
Taf15	T	C	11: 83,487,296	Y121H	possibly damaging	Het
Tdh	T	C	14: 63,496,055	Y113C	probably damaging	Het
Tgfbr1	T	A	4: 47,410,688	W406R	probably damaging	Het
Tgm6	A	G	2: 130,151,282	I563V	possibly damaging	Het
Tmem131	A	G	1: 36,827,009		probably null	Het
Tmub2	T	C	11: 102,287,486	S72P	probably benign	Het
Trappc13	G	A	13: 104,150,143	T202I	probably damaging	Het
Trim9	T	C	12: 70,272,428	E449G	probably damaging	Het
Trip11	C	A	12: 101,912,767	G21V	unknown	Het
Ttll12	G	A	15: 83,588,655	R127C	probably damaging	Het
Vmn2r125	A	T	4: 156,351,152	Y275F	probably damaging	Het
Xrcc5	A	G	1: 72,329,944	D319G	probably damaging	Het
Zc3h14	T	G	12: 98,785,003	C159W	probably damaging	Het
Zc3h7b	C	T	15: 81,777,088	P376L	probably benign	Het
Zfhx3	C	T	8: 108,948,489	P2057L	probably damaging	Het

Other mutations in Rapgef6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:Rapgef6	APN	11	54679265	missense	probably benign	0.00
IGL00507:Rapgef6	APN	11	54664109	nonsense	probably null
IGL00809:Rapgef6	APN	11	54649300	missense	probably damaging	1.00
IGL00843:Rapgef6	APN	11	54691273	missense	probably benign	0.03
IGL00899:Rapgef6	APN	11	54620018	nonsense	probably null
IGL01372:Rapgef6	APN	11	54668611	splice site	probably benign
IGL01604:Rapgef6	APN	11	54694563	missense	probably damaging	0.99
IGL01935:Rapgef6	APN	11	54610842	missense	possibly damaging	0.78
IGL01991:Rapgef6	APN	11	54552869	missense	probably benign	0.37
IGL02243:Rapgef6	APN	11	54676400	missense	probably damaging	1.00
IGL02407:Rapgef6	APN	11	54676355	missense	possibly damaging	0.91
IGL02676:Rapgef6	APN	11	54649346	unclassified	probably benign
IGL02934:Rapgef6	APN	11	54625864	missense	probably damaging	1.00
IGL03076:Rapgef6	APN	11	54625967	missense	probably damaging	1.00
IGL03110:Rapgef6	APN	11	54696089	missense	probably damaging	0.97
IGL03256:Rapgef6	APN	11	54657429	missense	probably damaging	1.00
shocker	UTSW	11	54620016	missense	probably damaging	1.00
D4216:Rapgef6	UTSW	11	54668746	splice site	probably benign
PIT4305001:Rapgef6	UTSW	11	54679377	missense	probably damaging	1.00
PIT4366001:Rapgef6	UTSW	11	54691620	missense	probably damaging	0.98
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0125:Rapgef6	UTSW	11	54625875	nonsense	probably null
R0189:Rapgef6	UTSW	11	54691249	missense	probably benign
R0201:Rapgef6	UTSW	11	54619941	missense	probably damaging	1.00
R0505:Rapgef6	UTSW	11	54625963	missense	probably benign	0.00
R0524:Rapgef6	UTSW	11	54690284	missense	probably benign	0.32
R0853:Rapgef6	UTSW	11	54668677	missense	probably damaging	1.00
R1203:Rapgef6	UTSW	11	54691699	missense	probably benign	0.09
R1440:Rapgef6	UTSW	11	54626708	missense	probably damaging	1.00
R1453:Rapgef6	UTSW	11	54639727	splice site	probably null
R1593:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1620:Rapgef6	UTSW	11	54626594	missense	possibly damaging	0.88
R1628:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1629:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1630:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1634:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1640:Rapgef6	UTSW	11	54657405	missense	probably damaging	1.00
R1686:Rapgef6	UTSW	11	54691632	missense	possibly damaging	0.81
R1722:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1743:Rapgef6	UTSW	11	54676284	missense	probably damaging	1.00
R1816:Rapgef6	UTSW	11	54694488	missense	probably benign
R1851:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1852:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1868:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1942:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R1943:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R2031:Rapgef6	UTSW	11	54552858	missense	probably benign	0.30
R2087:Rapgef6	UTSW	11	54631249	missense	probably damaging	1.00
R2106:Rapgef6	UTSW	11	54668686	missense	probably benign	0.17
R2362:Rapgef6	UTSW	11	54694272	missense	probably damaging	1.00
R2484:Rapgef6	UTSW	11	54642756	missense	possibly damaging	0.48
R2566:Rapgef6	UTSW	11	54687711	missense	possibly damaging	0.66
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R3744:Rapgef6	UTSW	11	54625934	missense	probably benign	0.40
R3848:Rapgef6	UTSW	11	54691308	missense	probably damaging	0.97
R4823:Rapgef6	UTSW	11	54694500	missense	probably benign	0.08
R4859:Rapgef6	UTSW	11	54636163	missense	probably benign
R4906:Rapgef6	UTSW	11	54552836	missense	probably damaging	1.00
R4911:Rapgef6	UTSW	11	54622317	missense	probably damaging	0.97
R4937:Rapgef6	UTSW	11	54657317	missense	probably damaging	1.00
R5033:Rapgef6	UTSW	11	54691381	missense	possibly damaging	0.92
R5249:Rapgef6	UTSW	11	54523117	missense	probably benign	0.19
R5304:Rapgef6	UTSW	11	54657374	missense	probably benign	0.01
R5656:Rapgef6	UTSW	11	54636136	missense	possibly damaging	0.95
R5701:Rapgef6	UTSW	11	54676394	missense	possibly damaging	0.76
R5758:Rapgef6	UTSW	11	54668644	missense	probably damaging	1.00
R5973:Rapgef6	UTSW	11	54639783	missense	probably damaging	1.00
R6177:Rapgef6	UTSW	11	54620016	missense	probably damaging	1.00
R6268:Rapgef6	UTSW	11	54649247	missense	probably damaging	1.00
R6287:Rapgef6	UTSW	11	54626338	splice site	probably null
R6293:Rapgef6	UTSW	11	54634781	missense	probably damaging	1.00
R6471:Rapgef6	UTSW	11	54691737	missense	probably damaging	0.99
R6863:Rapgef6	UTSW	11	54546380	missense	probably benign	0.00
R6950:Rapgef6	UTSW	11	54676380	missense	probably benign	0.09
R7144:Rapgef6	UTSW	11	54657365	missense	possibly damaging	0.78
R7171:Rapgef6	UTSW	11	54676363	missense	possibly damaging	0.94
R7199:Rapgef6	UTSW	11	54546426	missense	probably benign	0.00
R7291:Rapgef6	UTSW	11	54691239	missense	probably benign	0.05
R7436:Rapgef6	UTSW	11	54610921	critical splice donor site	probably null
R7498:Rapgef6	UTSW	11	54620004	missense	probably damaging	1.00
R7506:Rapgef6	UTSW	11	54636171	missense	probably benign	0.00
R7527:Rapgef6	UTSW	11	54634961	missense	unknown
R7646:Rapgef6	UTSW	11	54625954	missense	probably benign	0.00
R7655:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7656:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7687:Rapgef6	UTSW	11	54661075	missense	possibly damaging	0.93
R7768:Rapgef6	UTSW	11	54626588	missense	probably damaging	1.00
R7788:Rapgef6	UTSW	11	54694399	missense	probably damaging	1.00
R7890:Rapgef6	UTSW	11	54626723	missense	probably damaging	1.00
R8113:Rapgef6	UTSW	11	54625958	missense	probably benign	0.03
R8337:Rapgef6	UTSW	11	54631301	nonsense	probably null
R8393:Rapgef6	UTSW	11	54687661	missense	probably benign
R8465:Rapgef6	UTSW	11	54691482	missense	probably benign	0.00
R8492:Rapgef6	UTSW	11	54690237	missense	probably damaging	0.99
R8791:Rapgef6	UTSW	11	54568469	missense	probably benign	0.15
R8866:Rapgef6	UTSW	11	54552874	critical splice donor site	probably null
R8917:Rapgef6	UTSW	11	54691566	nonsense	probably null
R8921:Rapgef6	UTSW	11	54679239	missense	probably benign	0.09
R9031:Rapgef6	UTSW	11	54687841	missense	probably benign	0.00
R9093:Rapgef6	UTSW	11	54597086	nonsense	probably null
R9354:Rapgef6	UTSW	11	54619923	missense	possibly damaging	0.66
R9514:Rapgef6	UTSW	11	54552858	missense	probably benign	0.14
R9516:Rapgef6	UTSW	11	54691343	missense	probably damaging	1.00
R9739:Rapgef6	UTSW	11	54622363	missense	probably benign	0.03
R9789:Rapgef6	UTSW	11	54649271	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CACCCAGCTCTCCATGAGAGACTT -3'
(R):5'- TATCAGGAATCTCCAGGGGCCACT -3'

Sequencing Primer
(F):5'- CGTAACATTGAGCCTACTGAATAC -3'
(R):5'- ggaagaggaggtggaaagatag -3'

Posted On

2014-04-13