Incidental Mutation 'R1530:Rapgef6'
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene NameRap guanine nucleotide exchange factor (GEF) 6
SynonymsPDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2
MMRRC Submission 039569-MU
Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1530 (G1)
Quality Score225
Status Not validated
Chromosomal Location54522847-54699285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54661183 bp
Amino Acid Change Isoleucine to Lysine at position 959 (I959K)
Ref Sequence ENSEMBL: ENSMUSP00000147135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000207429]
Predicted Effect probably damaging
Transcript: ENSMUST00000094536
AA Change: I669K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533
AA Change: I669K

cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 853 3.88e-84 SMART
low complexity region 944 957 N/A INTRINSIC
low complexity region 972 989 N/A INTRINSIC
low complexity region 1016 1061 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101206
AA Change: I954K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: I954K

internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102743
AA Change: I954K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: I954K

internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108894
AA Change: I669K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533
AA Change: I669K

cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 810 5.35e-87 SMART
low complexity region 952 965 N/A INTRINSIC
low complexity region 980 997 N/A INTRINSIC
low complexity region 1024 1069 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175600
Predicted Effect probably damaging
Transcript: ENSMUST00000207429
AA Change: I959K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b T C 5: 137,569,378 C425R probably damaging Het
Adam15 A G 3: 89,349,830 S20P probably damaging Het
Adgra3 G A 5: 49,961,137 T1023I probably benign Het
Angel2 T A 1: 190,939,088 V46E probably damaging Het
Ankrd13c T A 3: 157,991,721 M321K probably damaging Het
Atad2b C T 12: 4,942,018 R206* probably null Het
Atp10b T A 11: 43,197,524 F319Y probably benign Het
AW554918 A G 18: 25,400,104 R272G probably damaging Het
BC027072 A G 17: 71,749,478 V1068A probably benign Het
Bpi T A 2: 158,261,145 I70N probably damaging Het
Brca1 T C 11: 101,524,695 D871G probably damaging Het
Capn3 G A 2: 120,482,208 A160T probably damaging Het
Cenpe T C 3: 135,246,902 L1451P possibly damaging Het
Chmp7 A G 14: 69,732,488 M1T probably null Het
Csrnp1 G C 9: 119,973,546 Q200E possibly damaging Het
Dscam G A 16: 96,819,874 P545S probably damaging Het
Erap1 A G 13: 74,646,543 E107G probably benign Het
Errfi1 A G 4: 150,865,386 I49V probably benign Het
Fam160b1 T A 19: 57,386,305 I704N probably damaging Het
Fam171b T C 2: 83,880,189 L735S probably damaging Het
Fancm T A 12: 65,092,490 probably null Het
Fbp2 G C 13: 62,837,159 P316R probably damaging Het
Fcer2a C A 8: 3,682,976 G255V probably damaging Het
Fzd2 T C 11: 102,605,308 S193P probably benign Het
Gak A G 5: 108,624,193 V86A probably damaging Het
Gas2l3 A G 10: 89,433,769 I7T probably benign Het
Gbp11 T C 5: 105,327,489 H331R probably damaging Het
Gpr19 C T 6: 134,869,998 V241M probably damaging Het
Grk6 G A 13: 55,458,799 A437T probably damaging Het
Hip1 T C 5: 135,444,780 D253G probably damaging Het
Ifna9 G C 4: 88,592,172 Q72E possibly damaging Het
Il1r1 A G 1: 40,312,361 T384A probably benign Het
Ip6k1 C A 9: 108,045,562 C221* probably null Het
Kcna1 C A 6: 126,642,531 E275D probably benign Het
Kcnt2 C T 1: 140,484,232 Q468* probably null Het
Kin T C 2: 10,092,339 V333A probably damaging Het
Leprot G T 4: 101,656,287 V91L probably benign Het
Mettl21c A G 1: 44,017,184 probably null Het
Myom2 T C 8: 15,122,384 F1161S probably damaging Het
Ndor1 A G 2: 25,248,909 L321P probably benign Het
Nipal2 A T 15: 34,625,022 *72K probably null Het
Nol3 T C 8: 105,279,226 V84A probably benign Het
Olfr1188 A T 2: 88,559,483 I5F probably benign Het
Olfr1388 C T 11: 49,443,905 S18L probably benign Het
Olfr901 T C 9: 38,430,324 I14T probably damaging Het
Pdgfra T A 5: 75,189,010 probably null Het
Pik3cb T C 9: 99,053,973 D802G probably damaging Het
Plac8l1 A T 18: 42,178,931 V141E probably damaging Het
Plxnb2 A G 15: 89,167,192 S275P probably benign Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Scn5a T C 9: 119,495,562 K1400R probably damaging Het
Sel1l A G 12: 91,826,684 S263P probably damaging Het
Setd5 G A 6: 113,109,913 V34I probably damaging Het
Slc17a2 A G 13: 23,819,069 D234G probably damaging Het
Spink5 T A 18: 44,015,671 S934T probably damaging Het
St18 A C 1: 6,845,569 probably null Het
St3gal4 T C 9: 35,052,296 I239V probably benign Het
Stag3 C T 5: 138,297,412 T399I probably damaging Het
Syt11 T C 3: 88,762,367 K6E probably damaging Het
Taf15 T C 11: 83,487,296 Y121H possibly damaging Het
Tdh T C 14: 63,496,055 Y113C probably damaging Het
Tgfbr1 T A 4: 47,410,688 W406R probably damaging Het
Tgm6 A G 2: 130,151,282 I563V possibly damaging Het
Tmem131 A G 1: 36,827,009 probably null Het
Tmub2 T C 11: 102,287,486 S72P probably benign Het
Trappc13 G A 13: 104,150,143 T202I probably damaging Het
Trim9 T C 12: 70,272,428 E449G probably damaging Het
Trip11 C A 12: 101,912,767 G21V unknown Het
Ttll12 G A 15: 83,588,655 R127C probably damaging Het
Vmn2r125 A T 4: 156,351,152 Y275F probably damaging Het
Xrcc5 A G 1: 72,329,944 D319G probably damaging Het
Zc3h14 T G 12: 98,785,003 C159W probably damaging Het
Zc3h7b C T 15: 81,777,088 P376L probably benign Het
Zfhx3 C T 8: 108,948,489 P2057L probably damaging Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54679265 missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54664109 nonsense probably null
IGL00809:Rapgef6 APN 11 54649300 missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54691273 missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54620018 nonsense probably null
IGL01372:Rapgef6 APN 11 54668611 splice site probably benign
IGL01604:Rapgef6 APN 11 54694563 missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54610842 missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54552869 missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54676400 missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54676355 missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54649346 unclassified probably benign
IGL02934:Rapgef6 APN 11 54625864 missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54625967 missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54696089 missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54657429 missense probably damaging 1.00
shocker UTSW 11 54620016 missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54668746 splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54679377 missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54691620 missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54625875 nonsense probably null
R0189:Rapgef6 UTSW 11 54691249 missense probably benign
R0201:Rapgef6 UTSW 11 54619941 missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54625963 missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54690284 missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54668677 missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54691699 missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54626708 missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54639727 splice site probably null
R1593:Rapgef6 UTSW 11 54546397 frame shift probably null
R1620:Rapgef6 UTSW 11 54626594 missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54546397 frame shift probably null
R1629:Rapgef6 UTSW 11 54546397 frame shift probably null
R1630:Rapgef6 UTSW 11 54546397 frame shift probably null
R1634:Rapgef6 UTSW 11 54546397 frame shift probably null
R1640:Rapgef6 UTSW 11 54657405 missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54691632 missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54546397 frame shift probably null
R1743:Rapgef6 UTSW 11 54676284 missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54694488 missense probably benign
R1851:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54546397 frame shift probably null
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54552858 missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54631249 missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54668686 missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54694272 missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54642756 missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54687711 missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54625934 missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54691308 missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54694500 missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54636163 missense probably benign
R4906:Rapgef6 UTSW 11 54552836 missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54622317 missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54657317 missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54691381 missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54523117 missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54657374 missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54636136 missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54676394 missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54668644 missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54639783 missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54620016 missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54649247 missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54626338 splice site probably null
R6293:Rapgef6 UTSW 11 54634781 missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54691737 missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54546380 missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54676380 missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54657365 missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54676363 missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54546426 missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54691239 missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54610921 critical splice donor site probably null
R7498:Rapgef6 UTSW 11 54620004 missense probably damaging 1.00
R7506:Rapgef6 UTSW 11 54636171 missense probably benign 0.00
R7527:Rapgef6 UTSW 11 54634961 missense unknown
R7646:Rapgef6 UTSW 11 54625954 missense probably benign 0.00
R7655:Rapgef6 UTSW 11 54694453 missense probably benign 0.10
R7656:Rapgef6 UTSW 11 54694453 missense probably benign 0.10
R7687:Rapgef6 UTSW 11 54661075 missense possibly damaging 0.93
R7768:Rapgef6 UTSW 11 54626588 missense probably damaging 1.00
R7788:Rapgef6 UTSW 11 54694399 missense probably damaging 1.00
R7890:Rapgef6 UTSW 11 54626723 missense probably damaging 1.00
R8113:Rapgef6 UTSW 11 54625958 missense probably benign 0.03
R8337:Rapgef6 UTSW 11 54631301 nonsense probably null
R8393:Rapgef6 UTSW 11 54687661 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ggaagaggaggtggaaagatag -3'
Posted On2014-04-13