Mutagenetix > Incidental Mutations

Incidental Mutation 'R1530:Plxnb2'

166588

Institutional Source

Beutler Lab

Gene Symbol

Plxnb2

Ensembl Gene

ENSMUSG00000036606

Gene Name

plexin B2

Synonyms

Debt, 1110007H23Rik

MMRRC Submission

039569-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.956) question?

Stock #

R1530 (G1)

Quality Score

210

Status

Not validated

Chromosome

Chromosomal Location

89155549-89180788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 89167192 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 275 (S275P)

Ref Sequence

ENSEMBL: ENSMUSP00000104955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060808] [ENSMUST00000109331]

Predicted Effect

probably benign
Transcript: ENSMUST00000060808
AA Change: S275P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000051731
Gene: ENSMUSG00000036606
AA Change: S275P

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1275	1809	1.6e-225	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109331
AA Change: S275P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000104955
Gene: ENSMUSG00000036606
AA Change: S275P

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Sema	34	452	8.87e-92	SMART
PSI	470	521	1.94e-10	SMART
PSI	616	669	4.09e-1	SMART
PSI	761	804	7.02e-8	SMART
IPT	805	896	8.14e-19	SMART
IPT	897	983	1.1e-15	SMART
IPT	985	1096	5.06e-6	SMART
Pfam:Plexin_cytopl	1274	1809	4.4e-251	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131062

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197760

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the B class of plexins, such as PLXNB2 are transmembrane receptors that participate in axon guidance and cell migration in response to semaphorins (Perrot et al. (2002) [PubMed 12183458]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a targeted mutation of this gene die perinatally of exencephaly or survive and seem normal despite severe abnormalities in cerebellar layering and foliation; the external granule cell layer is disorganized due to continued proliferation and migration of differentiated granule cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actl6b	T	C	5: 137,569,378	C425R	probably damaging	Het
Adam15	A	G	3: 89,349,830	S20P	probably damaging	Het
Adgra3	G	A	5: 49,961,137	T1023I	probably benign	Het
Angel2	T	A	1: 190,939,088	V46E	probably damaging	Het
Ankrd13c	T	A	3: 157,991,721	M321K	probably damaging	Het
Atad2b	C	T	12: 4,942,018	R206*	probably null	Het
Atp10b	T	A	11: 43,197,524	F319Y	probably benign	Het
AW554918	A	G	18: 25,400,104	R272G	probably damaging	Het
BC027072	A	G	17: 71,749,478	V1068A	probably benign	Het
Bpi	T	A	2: 158,261,145	I70N	probably damaging	Het
Brca1	T	C	11: 101,524,695	D871G	probably damaging	Het
Capn3	G	A	2: 120,482,208	A160T	probably damaging	Het
Cenpe	T	C	3: 135,246,902	L1451P	possibly damaging	Het
Chmp7	A	G	14: 69,732,488	M1T	probably null	Het
Csrnp1	G	C	9: 119,973,546	Q200E	possibly damaging	Het
Dscam	G	A	16: 96,819,874	P545S	probably damaging	Het
Erap1	A	G	13: 74,646,543	E107G	probably benign	Het
Errfi1	A	G	4: 150,865,386	I49V	probably benign	Het
Fam160b1	T	A	19: 57,386,305	I704N	probably damaging	Het
Fam171b	T	C	2: 83,880,189	L735S	probably damaging	Het
Fancm	T	A	12: 65,092,490		probably null	Het
Fbp2	G	C	13: 62,837,159	P316R	probably damaging	Het
Fcer2a	C	A	8: 3,682,976	G255V	probably damaging	Het
Fzd2	T	C	11: 102,605,308	S193P	probably benign	Het
Gak	A	G	5: 108,624,193	V86A	probably damaging	Het
Gas2l3	A	G	10: 89,433,769	I7T	probably benign	Het
Gbp11	T	C	5: 105,327,489	H331R	probably damaging	Het
Gpr19	C	T	6: 134,869,998	V241M	probably damaging	Het
Grk6	G	A	13: 55,458,799	A437T	probably damaging	Het
Hip1	T	C	5: 135,444,780	D253G	probably damaging	Het
Ifna9	G	C	4: 88,592,172	Q72E	possibly damaging	Het
Il1r1	A	G	1: 40,312,361	T384A	probably benign	Het
Ip6k1	C	A	9: 108,045,562	C221*	probably null	Het
Kcna1	C	A	6: 126,642,531	E275D	probably benign	Het
Kcnt2	C	T	1: 140,484,232	Q468*	probably null	Het
Kin	T	C	2: 10,092,339	V333A	probably damaging	Het
Leprot	G	T	4: 101,656,287	V91L	probably benign	Het
Mettl21c	A	G	1: 44,017,184		probably null	Het
Myom2	T	C	8: 15,122,384	F1161S	probably damaging	Het
Ndor1	A	G	2: 25,248,909	L321P	probably benign	Het
Nipal2	A	T	15: 34,625,022	*72K	probably null	Het
Nol3	T	C	8: 105,279,226	V84A	probably benign	Het
Olfr1188	A	T	2: 88,559,483	I5F	probably benign	Het
Olfr1388	C	T	11: 49,443,905	S18L	probably benign	Het
Olfr901	T	C	9: 38,430,324	I14T	probably damaging	Het
Pdgfra	T	A	5: 75,189,010		probably null	Het
Pik3cb	T	C	9: 99,053,973	D802G	probably damaging	Het
Plac8l1	A	T	18: 42,178,931	V141E	probably damaging	Het
Prl3b1	G	A	13: 27,243,865	A53T	probably benign	Het
Rapgef6	T	A	11: 54,661,183	I959K	probably damaging	Het
Scn5a	T	C	9: 119,495,562	K1400R	probably damaging	Het
Sel1l	A	G	12: 91,826,684	S263P	probably damaging	Het
Setd5	G	A	6: 113,109,913	V34I	probably damaging	Het
Slc17a2	A	G	13: 23,819,069	D234G	probably damaging	Het
Spink5	T	A	18: 44,015,671	S934T	probably damaging	Het
St18	A	C	1: 6,845,569		probably null	Het
St3gal4	T	C	9: 35,052,296	I239V	probably benign	Het
Stag3	C	T	5: 138,297,412	T399I	probably damaging	Het
Syt11	T	C	3: 88,762,367	K6E	probably damaging	Het
Taf15	T	C	11: 83,487,296	Y121H	possibly damaging	Het
Tdh	T	C	14: 63,496,055	Y113C	probably damaging	Het
Tgfbr1	T	A	4: 47,410,688	W406R	probably damaging	Het
Tgm6	A	G	2: 130,151,282	I563V	possibly damaging	Het
Tmem131	A	G	1: 36,827,009		probably null	Het
Tmub2	T	C	11: 102,287,486	S72P	probably benign	Het
Trappc13	G	A	13: 104,150,143	T202I	probably damaging	Het
Trim9	T	C	12: 70,272,428	E449G	probably damaging	Het
Trip11	C	A	12: 101,912,767	G21V	unknown	Het
Ttll12	G	A	15: 83,588,655	R127C	probably damaging	Het
Vmn2r125	A	T	4: 156,351,152	Y275F	probably damaging	Het
Xrcc5	A	G	1: 72,329,944	D319G	probably damaging	Het
Zc3h14	T	G	12: 98,785,003	C159W	probably damaging	Het
Zc3h7b	C	T	15: 81,777,088	P376L	probably benign	Het
Zfhx3	C	T	8: 108,948,489	P2057L	probably damaging	Het

Other mutations in Plxnb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00546:Plxnb2	APN	15	89162366	splice site	probably benign
IGL01574:Plxnb2	APN	15	89162683	splice site	probably null
IGL01695:Plxnb2	APN	15	89157214	missense	possibly damaging	0.96
IGL01763:Plxnb2	APN	15	89161981	splice site	probably null
IGL01921:Plxnb2	APN	15	89164271	missense	possibly damaging	0.78
IGL02129:Plxnb2	APN	15	89160410	missense	probably benign	0.04
IGL02153:Plxnb2	APN	15	89165813	nonsense	probably null
IGL02637:Plxnb2	APN	15	89164057	missense	possibly damaging	0.53
IGL02892:Plxnb2	APN	15	89161222	critical splice donor site	probably null
IGL03108:Plxnb2	APN	15	89158031	missense	probably benign	0.32
IGL03115:Plxnb2	APN	15	89162438	splice site	probably benign
P0040:Plxnb2	UTSW	15	89162935	missense	probably damaging	1.00
R0022:Plxnb2	UTSW	15	89163276	critical splice donor site	probably null
R0095:Plxnb2	UTSW	15	89165331	missense	probably benign
R0103:Plxnb2	UTSW	15	89161769	missense	possibly damaging	0.85
R0544:Plxnb2	UTSW	15	89158613	splice site	probably benign
R0671:Plxnb2	UTSW	15	89157981	missense	probably benign	0.14
R1279:Plxnb2	UTSW	15	89162321	missense	probably benign	0.02
R1542:Plxnb2	UTSW	15	89165921	missense	probably damaging	1.00
R1610:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
R1686:Plxnb2	UTSW	15	89162462	missense	probably damaging	1.00
R1702:Plxnb2	UTSW	15	89161984	critical splice donor site	probably null
R1996:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R1997:Plxnb2	UTSW	15	89158768	missense	probably benign	0.13
R2031:Plxnb2	UTSW	15	89162810	nonsense	probably null
R2049:Plxnb2	UTSW	15	89159002	missense	probably damaging	1.00
R2072:Plxnb2	UTSW	15	89158451	missense	probably damaging	1.00
R2076:Plxnb2	UTSW	15	89158026	missense	probably damaging	1.00
R2140:Plxnb2	UTSW	15	89156562	missense	probably benign	0.04
R2418:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R2419:Plxnb2	UTSW	15	89161069	missense	possibly damaging	0.72
R3752:Plxnb2	UTSW	15	89157255	splice site	probably benign
R3825:Plxnb2	UTSW	15	89166399	missense	probably benign	0.05
R4154:Plxnb2	UTSW	15	89159642	missense	probably damaging	0.98
R4197:Plxnb2	UTSW	15	89157018	missense	probably damaging	1.00
R4385:Plxnb2	UTSW	15	89160623	missense	probably damaging	0.96
R4434:Plxnb2	UTSW	15	89162803	missense	probably damaging	1.00
R4678:Plxnb2	UTSW	15	89160928	missense	probably benign	0.37
R4717:Plxnb2	UTSW	15	89157419	nonsense	probably null
R4773:Plxnb2	UTSW	15	89166947	missense	probably benign	0.06
R4905:Plxnb2	UTSW	15	89157411	missense	probably damaging	1.00
R5368:Plxnb2	UTSW	15	89159593	missense	possibly damaging	0.94
R5418:Plxnb2	UTSW	15	89166491	missense	probably benign	0.00
R5484:Plxnb2	UTSW	15	89164209	splice site	probably null
R5520:Plxnb2	UTSW	15	89167543	missense	possibly damaging	0.65
R5566:Plxnb2	UTSW	15	89164020	missense	probably benign	0.05
R5568:Plxnb2	UTSW	15	89157435	missense	probably damaging	1.00
R5619:Plxnb2	UTSW	15	89162809	missense	possibly damaging	0.92
R5685:Plxnb2	UTSW	15	89167032	missense	probably damaging	1.00
R5688:Plxnb2	UTSW	15	89158696	missense	probably damaging	1.00
R5809:Plxnb2	UTSW	15	89167571	missense	possibly damaging	0.61
R5813:Plxnb2	UTSW	15	89160759	missense	possibly damaging	0.81
R5866:Plxnb2	UTSW	15	89167572	missense	probably damaging	1.00
R6016:Plxnb2	UTSW	15	89161022	missense	possibly damaging	0.55
R6117:Plxnb2	UTSW	15	89158000	missense	probably benign	0.04
R6187:Plxnb2	UTSW	15	89167258	missense	probably damaging	1.00
R6260:Plxnb2	UTSW	15	89165291	missense	probably benign	0.22
R6263:Plxnb2	UTSW	15	89161986	missense	probably damaging	0.99
R6269:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
R6351:Plxnb2	UTSW	15	89157770	missense	possibly damaging	0.95
R6522:Plxnb2	UTSW	15	89164426	missense	probably benign	0.18
R6856:Plxnb2	UTSW	15	89164320	missense	probably benign	0.27
R6930:Plxnb2	UTSW	15	89160389	missense	probably benign
R7354:Plxnb2	UTSW	15	89165725	missense	possibly damaging	0.92
R7513:Plxnb2	UTSW	15	89158322	critical splice acceptor site	probably null
R7522:Plxnb2	UTSW	15	89161774	missense	probably benign	0.20
R7730:Plxnb2	UTSW	15	89162330	missense	probably benign
R7766:Plxnb2	UTSW	15	89161271	missense	probably benign	0.01
R7781:Plxnb2	UTSW	15	89157022	missense	possibly damaging	0.89
R8126:Plxnb2	UTSW	15	89163303	missense	probably benign
R8131:Plxnb2	UTSW	15	89158713	missense	probably damaging	1.00
R8372:Plxnb2	UTSW	15	89158493	missense	probably damaging	1.00
X0027:Plxnb2	UTSW	15	89160713	missense	probably benign	0.18
Z1177:Plxnb2	UTSW	15	89159096	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGGATCACAGCATCAGGACCAG -3'
(R):5'- TACTCAGCAGTTTGTCGCAGCC -3'

Sequencing Primer
(F):5'- CTACTAGGGCTCCAAGCTATAGG -3'
(R):5'- CGCAGCCTTTGAGGATGATTTC -3'

Posted On

2014-04-13