Incidental Mutation 'W0251:Bcl2a1b'
ID166608
Institutional Source Beutler Lab
Gene Symbol Bcl2a1b
Ensembl Gene ENSMUSG00000089929
Gene NameB cell leukemia/lymphoma 2 related protein A1b
SynonymsA1-b
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #W0251 (G3R) of strain daniel_gray
Quality Score222
Status Not validated
Chromosome9
Chromosomal Location89199209-89207827 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89199583 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 75 (M75K)
Ref Sequence ENSEMBL: ENSMUSP00000065612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068569]
Predicted Effect probably damaging
Transcript: ENSMUST00000068569
AA Change: M75K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065612
Gene: ENSMUSG00000089929
AA Change: M75K

DomainStartEndE-ValueType
BCL 37 140 5.55e-40 SMART
Predicted Effect unknown
Transcript: ENSMUST00000138109
AA Change: M68K
SMART Domains Protein: ENSMUSP00000119881
Gene: ENSMUSG00000100838
AA Change: M68K

DomainStartEndE-ValueType
BCL 31 134 5.55e-40 SMART
PDB:3HY6|A 135 221 4e-49 PDB
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Btaf1 G A 19: 37,003,504 R1575H probably damaging Het
Cfap46 T C 7: 139,603,946 M2507V probably benign Het
Dcc T C 18: 71,826,083 D206G probably damaging Het
Dnah6 T A 6: 73,178,518 I705F possibly damaging Het
Entpd1 A T 19: 40,726,253 I269F probably damaging Het
Gm4559 G C 7: 142,273,798 A189G unknown Het
Ipo5 T A 14: 120,938,785 M648K probably benign Het
Kdelr1 A G 7: 45,881,621 Y96C probably damaging Het
Mmp17 C T 5: 129,595,527 A181V probably benign Het
Muc20 T C 16: 32,793,853 I385V possibly damaging Het
Olfr155 C T 4: 43,855,058 L250F probably benign Het
Pik3r6 A G 11: 68,533,871 Y434C probably benign Het
Pura T C 18: 36,287,790 V210A probably benign Het
Spic C T 10: 88,679,904 D19N probably damaging Het
Other mutations in Bcl2a1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0379:Bcl2a1b UTSW 9 89199736 missense possibly damaging 0.95
R1307:Bcl2a1b UTSW 9 89199490 missense probably damaging 0.99
R2402:Bcl2a1b UTSW 9 89199742 missense probably benign 0.06
R4898:Bcl2a1b UTSW 9 89199660 nonsense probably null
R5098:Bcl2a1b UTSW 9 89199379 missense probably benign 0.00
R5710:Bcl2a1b UTSW 9 89199679 missense probably benign 0.01
R6594:Bcl2a1b UTSW 9 89207594 missense probably benign
R7059:Bcl2a1b UTSW 9 89199760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATATCCACTCCCTGGCTGAGCAC -3'
(R):5'- TTTCAAGTAGAGGCCATTGGAAAGGAC -3'

Sequencing Primer
(F):5'- GGCTGAGCACTATCTTCAGTATG -3'
(R):5'- CAGACTGAAGTCCTTTGATTGTTAC -3'
Posted On2014-04-13