Incidental Mutation 'W0251:Spic'
ID 166609
Institutional Source Beutler Lab
Gene Symbol Spic
Ensembl Gene ENSMUSG00000004359
Gene Name Spi-C transcription factor (Spi-1/PU.1 related)
Synonyms Spi-C, C76795, Prf
Accession Numbers
Essential gene? Possibly essential (E-score: 0.587) question?
Stock # W0251 (G3R) of strain daniel_gray
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 88511131-88518885 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 88515766 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 19 (D19N)
Ref Sequence ENSEMBL: ENSMUSP00000114328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004473] [ENSMUST00000133724] [ENSMUST00000138734]
AlphaFold Q6P3D7
Predicted Effect possibly damaging
Transcript: ENSMUST00000004473
AA Change: D19N

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000004473
Gene: ENSMUSG00000004359
AA Change: D19N

DomainStartEndE-ValueType
ETS 111 199 6.67e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133724
AA Change: D19N

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000138734
AA Change: D19N

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118799
Gene: ENSMUSG00000004359
AA Change: D19N

DomainStartEndE-ValueType
ETS 111 167 1.14e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144338
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene regulates the development of red pulp macrophages, which are necessary for iron homeostasis and the recycling of red blood cells. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygote null mice have prenatal lethality with incomplete penetrance, absent red pulp macrophages, decreased phagocytosis of senescent red blood cell, and enlargement of spleens with age due to an increase in splenic iron levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl2a1b T A 9: 89,081,636 (GRCm39) M75K probably damaging Het
Btaf1 G A 19: 36,980,904 (GRCm39) R1575H probably damaging Het
Cfap46 T C 7: 139,183,862 (GRCm39) M2507V probably benign Het
Dcc T C 18: 71,959,154 (GRCm39) D206G probably damaging Het
Dnah6 T A 6: 73,155,501 (GRCm39) I705F possibly damaging Het
Entpd1 A T 19: 40,714,697 (GRCm39) I269F probably damaging Het
Gm4559 G C 7: 141,827,535 (GRCm39) A189G unknown Het
Ipo5 T A 14: 121,176,197 (GRCm39) M648K probably benign Het
Kdelr1 A G 7: 45,531,045 (GRCm39) Y96C probably damaging Het
Mmp17 C T 5: 129,672,591 (GRCm39) A181V probably benign Het
Muc20 T C 16: 32,614,223 (GRCm39) I385V possibly damaging Het
Or13c7 C T 4: 43,855,058 (GRCm39) L250F probably benign Het
Pik3r6 A G 11: 68,424,697 (GRCm39) Y434C probably benign Het
Pura T C 18: 36,420,843 (GRCm39) V210A probably benign Het
Other mutations in Spic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Spic APN 10 88,511,729 (GRCm39) missense probably damaging 1.00
IGL01503:Spic APN 10 88,511,623 (GRCm39) missense probably damaging 0.96
IGL01611:Spic APN 10 88,511,864 (GRCm39) missense possibly damaging 0.69
IGL01792:Spic APN 10 88,515,807 (GRCm39) missense possibly damaging 0.85
R0047:Spic UTSW 10 88,511,803 (GRCm39) missense probably damaging 1.00
R0047:Spic UTSW 10 88,511,803 (GRCm39) missense probably damaging 1.00
R0126:Spic UTSW 10 88,511,924 (GRCm39) missense probably damaging 1.00
R0166:Spic UTSW 10 88,511,579 (GRCm39) missense possibly damaging 0.84
R0585:Spic UTSW 10 88,511,905 (GRCm39) missense probably damaging 1.00
R4066:Spic UTSW 10 88,511,545 (GRCm39) missense possibly damaging 0.63
R4067:Spic UTSW 10 88,511,545 (GRCm39) missense possibly damaging 0.63
R4436:Spic UTSW 10 88,512,817 (GRCm39) missense probably benign 0.03
R4748:Spic UTSW 10 88,511,752 (GRCm39) missense probably damaging 1.00
R5001:Spic UTSW 10 88,511,761 (GRCm39) missense possibly damaging 0.61
R8165:Spic UTSW 10 88,513,428 (GRCm39) missense probably damaging 0.98
R8247:Spic UTSW 10 88,511,923 (GRCm39) missense probably damaging 1.00
R8411:Spic UTSW 10 88,514,498 (GRCm39) missense possibly damaging 0.74
R8681:Spic UTSW 10 88,511,847 (GRCm39) missense possibly damaging 0.89
R9700:Spic UTSW 10 88,515,757 (GRCm39) missense probably benign 0.14
R9777:Spic UTSW 10 88,514,421 (GRCm39) missense possibly damaging 0.59
X0018:Spic UTSW 10 88,514,427 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- agctttgcgaGTTTAGTAGGCTTCC -3'
(R):5'- GCTGACATTTCCGCAACCCAAG -3'

Sequencing Primer
(F):5'- TGTGTGCCAGGAGATGAGAGT -3'
(R):5'- ggaccgaacttgaccgaac -3'
Posted On 2014-04-13