Incidental Mutation 'W0251:Pik3r6'
ID 166610
Institutional Source Beutler Lab
Gene Symbol Pik3r6
Ensembl Gene ENSMUSG00000046207
Gene Name phosphoinositide-3-kinase regulatory subunit 5
Synonyms p87PIKAP, p84 Pikap
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # W0251 (G3R) of strain daniel_gray
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 68393845-68443524 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 68424697 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 434 (Y434C)
Ref Sequence ENSEMBL: ENSMUSP00000099673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060441] [ENSMUST00000102613]
AlphaFold Q3U6Q4
Predicted Effect probably benign
Transcript: ENSMUST00000060441
AA Change: Y434C

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000052522
Gene: ENSMUSG00000046207
AA Change: Y434C

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 7 306 7.4e-28 PFAM
low complexity region 310 324 N/A INTRINSIC
Pfam:PI3K_1B_p101 394 755 1.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102613
AA Change: Y434C

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000099673
Gene: ENSMUSG00000046207
AA Change: Y434C

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 3 335 1.8e-111 PFAM
Pfam:PI3K_1B_p101 332 752 1.6e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153671
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: Phosphoinositide 3-kinase gamma is a lipid kinase that produces the lipid second messenger phosphatidylinositol 3,4,5-trisphosphate. The kinase is composed of a catalytic subunit and one of several regulatory subunits, and is chiefly activated by G protein-coupled receptors. This gene encodes a regulatory subunit, and is distantly related to the phosphoinositide-3-kinase, regulatory subunit 5 gene which is located adjacent to this gene on chromosome 11. The protein binds to both the catalytic subunit and to G beta-gamma, and mediates activation of the kinase subunit downstream of G protein-coupled receptors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small reductions in lymphocyte and granulocyte and a slight increase in neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl2a1b T A 9: 89,081,636 (GRCm39) M75K probably damaging Het
Btaf1 G A 19: 36,980,904 (GRCm39) R1575H probably damaging Het
Cfap46 T C 7: 139,183,862 (GRCm39) M2507V probably benign Het
Dcc T C 18: 71,959,154 (GRCm39) D206G probably damaging Het
Dnah6 T A 6: 73,155,501 (GRCm39) I705F possibly damaging Het
Entpd1 A T 19: 40,714,697 (GRCm39) I269F probably damaging Het
Gm4559 G C 7: 141,827,535 (GRCm39) A189G unknown Het
Ipo5 T A 14: 121,176,197 (GRCm39) M648K probably benign Het
Kdelr1 A G 7: 45,531,045 (GRCm39) Y96C probably damaging Het
Mmp17 C T 5: 129,672,591 (GRCm39) A181V probably benign Het
Muc20 T C 16: 32,614,223 (GRCm39) I385V possibly damaging Het
Or13c7 C T 4: 43,855,058 (GRCm39) L250F probably benign Het
Pura T C 18: 36,420,843 (GRCm39) V210A probably benign Het
Spic C T 10: 88,515,766 (GRCm39) D19N probably damaging Het
Other mutations in Pik3r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Pik3r6 APN 11 68,425,077 (GRCm39) missense probably damaging 0.98
IGL00913:Pik3r6 APN 11 68,442,147 (GRCm39) missense probably damaging 1.00
IGL00984:Pik3r6 APN 11 68,424,445 (GRCm39) missense probably benign 0.39
IGL01110:Pik3r6 APN 11 68,419,652 (GRCm39) critical splice donor site probably null
IGL01116:Pik3r6 APN 11 68,422,276 (GRCm39) missense probably benign 0.01
IGL02839:Pik3r6 APN 11 68,417,238 (GRCm39) missense probably damaging 1.00
PIT4142001:Pik3r6 UTSW 11 68,417,931 (GRCm39) missense probably damaging 1.00
R0044:Pik3r6 UTSW 11 68,435,576 (GRCm39) missense probably benign 0.02
R0062:Pik3r6 UTSW 11 68,419,635 (GRCm39) missense probably damaging 1.00
R0062:Pik3r6 UTSW 11 68,419,635 (GRCm39) missense probably damaging 1.00
R0266:Pik3r6 UTSW 11 68,417,234 (GRCm39) nonsense probably null
R0454:Pik3r6 UTSW 11 68,419,608 (GRCm39) missense possibly damaging 0.88
R0906:Pik3r6 UTSW 11 68,426,927 (GRCm39) splice site probably benign
R1119:Pik3r6 UTSW 11 68,436,698 (GRCm39) missense probably benign 0.05
R1440:Pik3r6 UTSW 11 68,422,271 (GRCm39) missense possibly damaging 0.91
R1664:Pik3r6 UTSW 11 68,426,932 (GRCm39) missense probably benign
R1831:Pik3r6 UTSW 11 68,434,860 (GRCm39) missense probably benign 0.26
R2144:Pik3r6 UTSW 11 68,434,437 (GRCm39) nonsense probably null
R4013:Pik3r6 UTSW 11 68,424,347 (GRCm39) missense possibly damaging 0.85
R4754:Pik3r6 UTSW 11 68,435,601 (GRCm39) missense probably damaging 1.00
R4770:Pik3r6 UTSW 11 68,420,720 (GRCm39) missense probably damaging 1.00
R4860:Pik3r6 UTSW 11 68,434,879 (GRCm39) splice site probably benign
R4974:Pik3r6 UTSW 11 68,430,771 (GRCm39) missense probably damaging 1.00
R5033:Pik3r6 UTSW 11 68,424,294 (GRCm39) nonsense probably null
R5787:Pik3r6 UTSW 11 68,430,753 (GRCm39) missense possibly damaging 0.54
R5918:Pik3r6 UTSW 11 68,416,497 (GRCm39) nonsense probably null
R6164:Pik3r6 UTSW 11 68,442,799 (GRCm39) missense probably benign 0.00
R6192:Pik3r6 UTSW 11 68,434,455 (GRCm39) missense probably damaging 1.00
R6440:Pik3r6 UTSW 11 68,424,522 (GRCm39) missense probably benign 0.09
R7699:Pik3r6 UTSW 11 68,419,389 (GRCm39) missense probably damaging 1.00
R7700:Pik3r6 UTSW 11 68,419,389 (GRCm39) missense probably damaging 1.00
R7922:Pik3r6 UTSW 11 68,424,701 (GRCm39) missense probably benign 0.00
R7964:Pik3r6 UTSW 11 68,424,565 (GRCm39) missense probably benign 0.01
R8473:Pik3r6 UTSW 11 68,417,207 (GRCm39) missense probably benign 0.02
R8515:Pik3r6 UTSW 11 68,430,783 (GRCm39) missense probably damaging 1.00
R8883:Pik3r6 UTSW 11 68,424,468 (GRCm39) missense probably benign
R9545:Pik3r6 UTSW 11 68,422,365 (GRCm39) missense probably damaging 1.00
R9623:Pik3r6 UTSW 11 68,442,159 (GRCm39) missense possibly damaging 0.55
R9762:Pik3r6 UTSW 11 68,424,358 (GRCm39) nonsense probably null
Z1088:Pik3r6 UTSW 11 68,416,428 (GRCm39) missense probably damaging 0.98
Z1176:Pik3r6 UTSW 11 68,435,591 (GRCm39) missense probably benign 0.12
Z1176:Pik3r6 UTSW 11 68,411,026 (GRCm39) start gained probably benign
Z1177:Pik3r6 UTSW 11 68,442,053 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAAGGATTTAGGCTAGACCGGGAC -3'
(R):5'- TGGGCACTGGGGATACTCTACAATG -3'

Sequencing Primer
(F):5'- TGTCCACCGACAGTGGAATTG -3'
(R):5'- GGGGATACTCTACAATGTCCTTC -3'
Posted On 2014-04-13