Mutagenetix > Incidental Mutation

Incidental Mutation 'W0251:Ipo5'

166612

Institutional Source

Beutler Lab

Gene Symbol

Ipo5

Ensembl Gene

ENSMUSG00000030662

Gene Name

importin 5

Synonyms

1110011C18Rik, RanBP5, Kpnb3, importin beta 3, IMB3, 5730478E03Rik

Accession Numbers

Essential gene?

Probably essential (E-score: 0.928) question?

Stock #

W0251 (G3R) of strain daniel_gray

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121148636-121185411 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 121176197 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 648 (M648K)

Ref Sequence

ENSEMBL: ENSMUSP00000032898 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032898]

AlphaFold

Q8BKC5

Predicted Effect

probably benign
Transcript: ENSMUST00000032898
AA Change: M648K

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000032898
Gene: ENSMUSG00000030662
AA Change: M648K

Domain	Start	End	E-Value	Type
low complexity region	65	72	N/A	INTRINSIC
Pfam:HEAT_2	359	467	3.3e-13	PFAM
Pfam:HEAT_EZ	372	426	3.7e-10	PFAM
Pfam:Vac14_Fab1_bd	373	430	3.8e-9	PFAM
Pfam:HEAT	400	430	4.2e-7	PFAM
Pfam:HEAT	906	936	4.2e-6	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228277

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.5%
20x: 90.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(33) : Targeted, other(2) Gene trapped(31)

Other mutations in this stock

Total: 14 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Bcl2a1b	T	A	9: 89,081,636 (GRCm39)	M75K	probably damaging	Het
Btaf1	G	A	19: 36,980,904 (GRCm39)	R1575H	probably damaging	Het
Cfap46	T	C	7: 139,183,862 (GRCm39)	M2507V	probably benign	Het
Dcc	T	C	18: 71,959,154 (GRCm39)	D206G	probably damaging	Het
Dnah6	T	A	6: 73,155,501 (GRCm39)	I705F	possibly damaging	Het
Entpd1	A	T	19: 40,714,697 (GRCm39)	I269F	probably damaging	Het
Gm4559	G	C	7: 141,827,535 (GRCm39)	A189G	unknown	Het
Kdelr1	A	G	7: 45,531,045 (GRCm39)	Y96C	probably damaging	Het
Mmp17	C	T	5: 129,672,591 (GRCm39)	A181V	probably benign	Het
Muc20	T	C	16: 32,614,223 (GRCm39)	I385V	possibly damaging	Het
Or13c7	C	T	4: 43,855,058 (GRCm39)	L250F	probably benign	Het
Pik3r6	A	G	11: 68,424,697 (GRCm39)	Y434C	probably benign	Het
Pura	T	C	18: 36,420,843 (GRCm39)	V210A	probably benign	Het
Spic	C	T	10: 88,515,766 (GRCm39)	D19N	probably damaging	Het

Other mutations in Ipo5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01461:Ipo5	APN	14	121,165,945 (GRCm39)	missense	probably damaging	0.98
IGL01614:Ipo5	APN	14	121,172,507 (GRCm39)	missense	probably benign	0.01
IGL01835:Ipo5	APN	14	121,163,650 (GRCm39)	missense	probably benign	0.24
IGL02010:Ipo5	APN	14	121,170,789 (GRCm39)	missense	probably benign	0.20
IGL02303:Ipo5	APN	14	121,154,795 (GRCm39)	missense	probably benign
IGL02344:Ipo5	APN	14	121,180,191 (GRCm39)	splice site	probably benign
IGL02657:Ipo5	APN	14	121,181,212 (GRCm39)	missense	possibly damaging	0.47
IGL03094:Ipo5	APN	14	121,181,089 (GRCm39)	splice site	probably benign
IGL03158:Ipo5	APN	14	121,179,303 (GRCm39)	splice site	probably benign
IGL03309:Ipo5	APN	14	121,157,416 (GRCm39)	missense	probably benign
IGL03392:Ipo5	APN	14	121,180,099 (GRCm39)	missense	probably damaging	0.99
3-1:Ipo5	UTSW	14	121,170,348 (GRCm39)	missense	probably benign	0.41
PIT4544001:Ipo5	UTSW	14	121,165,949 (GRCm39)	missense	probably damaging	0.99
R0326:Ipo5	UTSW	14	121,159,635 (GRCm39)	missense	probably benign	0.19
R0505:Ipo5	UTSW	14	121,180,145 (GRCm39)	missense	possibly damaging	0.74
R0559:Ipo5	UTSW	14	121,176,053 (GRCm39)	missense	probably damaging	1.00
R0590:Ipo5	UTSW	14	121,181,769 (GRCm39)	missense	possibly damaging	0.76
R0969:Ipo5	UTSW	14	121,181,937 (GRCm39)	missense	possibly damaging	0.64
R1450:Ipo5	UTSW	14	121,181,805 (GRCm39)	missense	probably benign	0.04
R1672:Ipo5	UTSW	14	121,170,714 (GRCm39)	missense	probably damaging	1.00
R2471:Ipo5	UTSW	14	121,159,574 (GRCm39)	missense	probably benign	0.12
R3508:Ipo5	UTSW	14	121,176,956 (GRCm39)	missense	probably damaging	1.00
R3696:Ipo5	UTSW	14	121,159,574 (GRCm39)	missense	probably benign	0.12
R4118:Ipo5	UTSW	14	121,176,073 (GRCm39)	missense	probably benign	0.04
R4418:Ipo5	UTSW	14	121,181,305 (GRCm39)	missense	possibly damaging	0.81
R4760:Ipo5	UTSW	14	121,179,054 (GRCm39)	missense	probably benign	0.02
R4839:Ipo5	UTSW	14	121,157,450 (GRCm39)	missense	probably benign	0.00
R4913:Ipo5	UTSW	14	121,172,498 (GRCm39)	missense	probably damaging	1.00
R5326:Ipo5	UTSW	14	121,163,683 (GRCm39)	missense	probably benign
R5339:Ipo5	UTSW	14	121,181,122 (GRCm39)	missense	probably damaging	1.00
R5483:Ipo5	UTSW	14	121,157,450 (GRCm39)	missense	probably benign	0.06
R5542:Ipo5	UTSW	14	121,163,683 (GRCm39)	missense	probably benign
R5579:Ipo5	UTSW	14	121,176,025 (GRCm39)	missense	probably benign	0.26
R5954:Ipo5	UTSW	14	121,157,396 (GRCm39)	missense	probably damaging	1.00
R6948:Ipo5	UTSW	14	121,160,527 (GRCm39)	missense	probably benign	0.00
R7365:Ipo5	UTSW	14	121,157,497 (GRCm39)	missense	probably benign
R7563:Ipo5	UTSW	14	121,183,567 (GRCm39)	missense	probably benign	0.00
R7782:Ipo5	UTSW	14	121,170,537 (GRCm39)	missense	possibly damaging	0.95
R7911:Ipo5	UTSW	14	121,167,051 (GRCm39)	splice site	probably null
R8222:Ipo5	UTSW	14	121,157,414 (GRCm39)	missense	probably benign	0.00
R8238:Ipo5	UTSW	14	121,172,652 (GRCm39)	missense	probably damaging	1.00
R8483:Ipo5	UTSW	14	121,183,560 (GRCm39)	missense	probably benign
R8826:Ipo5	UTSW	14	121,157,366 (GRCm39)	missense	probably damaging	1.00
R9042:Ipo5	UTSW	14	121,160,547 (GRCm39)	missense	probably benign	0.01
X0062:Ipo5	UTSW	14	121,179,083 (GRCm39)	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AAAGAATTCCAGCAGTACCTTCCCG -3'
(R):5'- TCCTCTGAACTGAGTTTGTGTGCC -3'

Sequencing Primer
(F):5'- TTCACCAGGACATGGTAGCT -3'
(R):5'- TGTGCGCTCACACACATAC -3'

Posted On

2014-04-13