Incidental Mutation 'R1532:Tpr'
Institutional Source Beutler Lab
Gene Symbol Tpr
Ensembl Gene ENSMUSG00000006005
Gene Nametranslocated promoter region, nuclear basket protein
MMRRC Submission 039571-MU
Accession Numbers

Genbank: NM_133780; MGI: 1922066

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1532 (G1)
Quality Score225
Status Not validated
Chromosomal Location150392838-150449935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 150418000 bp
Amino Acid Change Isoleucine to Lysine at position 915 (I915K)
Ref Sequence ENSEMBL: ENSMUSP00000117616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119161] [ENSMUST00000124973]
Predicted Effect probably damaging
Transcript: ENSMUST00000119161
AA Change: I841K

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112606
Gene: ENSMUSG00000006005
AA Change: I841K

coiled coil region 49 370 N/A INTRINSIC
coiled coil region 423 515 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
coiled coil region 539 604 N/A INTRINSIC
low complexity region 690 703 N/A INTRINSIC
low complexity region 782 795 N/A INTRINSIC
low complexity region 811 826 N/A INTRINSIC
low complexity region 1003 1019 N/A INTRINSIC
Pfam:TPR_MLP1_2 1036 1167 9.1e-33 PFAM
coiled coil region 1215 1421 N/A INTRINSIC
coiled coil region 1473 1629 N/A INTRINSIC
internal_repeat_3 1630 1691 1.48e-5 PROSPERO
low complexity region 1695 1717 N/A INTRINSIC
low complexity region 1761 1777 N/A INTRINSIC
internal_repeat_5 1814 1827 5.58e-5 PROSPERO
internal_repeat_3 1819 1881 1.48e-5 PROSPERO
internal_repeat_4 1875 1895 5.58e-5 PROSPERO
internal_repeat_1 1893 1919 2.03e-6 PROSPERO
low complexity region 1920 1933 N/A INTRINSIC
low complexity region 1942 1981 N/A INTRINSIC
low complexity region 1989 2014 N/A INTRINSIC
internal_repeat_4 2017 2036 5.58e-5 PROSPERO
low complexity region 2059 2078 N/A INTRINSIC
internal_repeat_2 2084 2135 3.95e-6 PROSPERO
internal_repeat_5 2127 2140 5.58e-5 PROSPERO
internal_repeat_1 2154 2179 2.03e-6 PROSPERO
internal_repeat_2 2156 2212 3.95e-6 PROSPERO
low complexity region 2239 2251 N/A INTRINSIC
low complexity region 2263 2277 N/A INTRINSIC
low complexity region 2292 2314 N/A INTRINSIC
low complexity region 2346 2357 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124973
AA Change: I915K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117616
Gene: ENSMUSG00000006005
AA Change: I915K

low complexity region 3 14 N/A INTRINSIC
low complexity region 24 77 N/A INTRINSIC
coiled coil region 123 444 N/A INTRINSIC
coiled coil region 497 589 N/A INTRINSIC
low complexity region 592 608 N/A INTRINSIC
coiled coil region 613 678 N/A INTRINSIC
low complexity region 764 777 N/A INTRINSIC
low complexity region 856 869 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
Pfam:TPR_MLP1_2 1112 1240 5.1e-37 PFAM
coiled coil region 1289 1495 N/A INTRINSIC
low complexity region 1682 1698 N/A INTRINSIC
internal_repeat_5 1703 1750 8.04e-5 PROSPERO
internal_repeat_3 1704 1765 1.07e-5 PROSPERO
low complexity region 1769 1791 N/A INTRINSIC
low complexity region 1835 1851 N/A INTRINSIC
internal_repeat_5 1857 1900 8.04e-5 PROSPERO
internal_repeat_6 1887 1911 8.04e-5 PROSPERO
internal_repeat_3 1893 1955 1.07e-5 PROSPERO
internal_repeat_4 1949 1969 4.1e-5 PROSPERO
internal_repeat_1 1967 1993 1.42e-6 PROSPERO
low complexity region 1994 2007 N/A INTRINSIC
low complexity region 2016 2055 N/A INTRINSIC
low complexity region 2063 2088 N/A INTRINSIC
internal_repeat_4 2091 2110 4.1e-5 PROSPERO
internal_repeat_6 2108 2132 8.04e-5 PROSPERO
low complexity region 2133 2152 N/A INTRINSIC
internal_repeat_2 2158 2209 2.78e-6 PROSPERO
internal_repeat_1 2228 2253 1.42e-6 PROSPERO
internal_repeat_2 2230 2286 2.78e-6 PROSPERO
low complexity region 2313 2325 N/A INTRINSIC
low complexity region 2337 2351 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2420 2431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147769
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled-coil protein that forms intranuclear filaments attached to the inner surface of nuclear pore complexes (NPCs). The protein directly interacts with several components of the NPC. It is required for the nuclear export of mRNAs and some proteins. Oncogenic fusions of the 5' end of this gene with several different kinase genes occur in some neoplasias. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(28) : Targeted, other(2) Gene trapped(26)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 C A 4: 86,248,065 H394N probably benign Het
Ahrr A G 13: 74,213,707 S558P probably benign Het
Ankrd26 T C 6: 118,522,958 N1184S probably damaging Het
Anpep A T 7: 79,826,948 C14* probably null Het
Arhgap18 A G 10: 26,860,722 D187G possibly damaging Het
Arhgef5 A G 6: 43,273,403 T363A probably benign Het
Atxn1 A T 13: 45,566,910 L503Q possibly damaging Het
Babam1 A G 8: 71,399,633 D155G possibly damaging Het
Bbs9 A G 9: 22,887,649 T858A probably benign Het
Cacna1g C A 11: 94,443,331 G828V probably damaging Het
Ccar2 T C 14: 70,142,956 T392A probably benign Het
Cd163 T C 6: 124,312,730 V469A possibly damaging Het
Cdh23 G T 10: 60,314,331 N2576K probably damaging Het
Coro2b A G 9: 62,489,423 Y18H probably damaging Het
Crispld2 G T 8: 120,023,572 K238N probably benign Het
Ctnnd2 T C 15: 30,921,868 I880T probably damaging Het
Cubn C A 2: 13,287,661 C3237F probably damaging Het
Ddx31 A G 2: 28,881,159 M519V probably benign Het
Dhx32 A T 7: 133,749,024 C106S possibly damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Dnaaf1 T C 8: 119,577,423 F67L probably benign Het
Duox1 T G 2: 122,344,723 L1334R probably damaging Het
Dync1li2 A T 8: 104,426,035 I322N probably damaging Het
Eml6 T C 11: 29,792,256 probably null Het
Entpd6 A G 2: 150,758,750 Q126R probably benign Het
Entpd7 C G 19: 43,691,077 P23R possibly damaging Het
Epha3 T C 16: 63,546,178 I970V probably benign Het
Fras1 A T 5: 96,713,996 H2163L probably damaging Het
Gse1 C G 8: 120,568,210 probably benign Het
Heatr5a A G 12: 51,952,518 V300A probably damaging Het
Hsd3b1 T A 3: 98,852,898 D259V probably damaging Het
Hspbap1 T C 16: 35,825,303 S453P probably damaging Het
Ifnl3 A G 7: 28,524,227 T163A probably benign Het
Igbp1b T A 6: 138,658,444 M1L possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lpxn T C 19: 12,804,092 probably null Het
Mast1 G A 8: 84,928,609 Q249* probably null Het
Mink1 A G 11: 70,602,007 D153G probably null Het
Mllt10 G A 2: 18,092,835 probably null Het
Mpl C T 4: 118,448,568 G420E possibly damaging Het
Ms4a1 T A 19: 11,253,193 T215S probably benign Het
Ncapd3 C T 9: 27,083,360 Q1179* probably null Het
Nr3c2 A G 8: 76,909,104 H278R probably damaging Het
Olfr1417 T C 19: 11,828,619 I136V probably benign Het
Olfr1454 A G 19: 13,064,275 Y288C probably damaging Het
Olfr670 T C 7: 104,960,265 I156V probably benign Het
Os9 C T 10: 127,098,902 V353M probably damaging Het
Osbpl5 A T 7: 143,695,080 M589K probably benign Het
Phf20 G T 2: 156,303,049 G859V possibly damaging Het
Pkhd1 G A 1: 20,117,401 T3561I probably benign Het
Prss46 G A 9: 110,850,168 V146I probably benign Het
Ptprk G A 10: 28,585,630 V1139M probably damaging Het
Ranbp10 A G 8: 105,774,331 L396P probably benign Het
Rb1cc1 A G 1: 6,249,734 T1126A probably benign Het
Rbl2 G A 8: 91,106,417 A659T probably benign Het
Rdm1 T C 11: 101,633,817 L192P probably damaging Het
Reln A C 5: 22,034,744 W842G probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sele A G 1: 164,053,851 K509R probably benign Het
Slc15a1 A T 14: 121,475,984 I377N possibly damaging Het
Slc17a3 G A 13: 23,856,500 G269D probably damaging Het
Slc35a5 T C 16: 45,151,557 T115A probably benign Het
Slc5a12 T G 2: 110,610,138 N157K possibly damaging Het
Sphkap A G 1: 83,257,203 V1634A probably damaging Het
Spta1 T C 1: 174,247,353 S2382P probably damaging Het
Synj2 C A 17: 6,033,919 S1100R probably benign Het
Tcf23 A G 5: 30,973,557 T180A probably benign Het
Tnxb T C 17: 34,710,830 V2846A probably damaging Het
Uba1y C T Y: 828,862 H557Y probably benign Het
Unc45b T A 11: 82,936,874 D730E probably benign Het
Unc5b A T 10: 60,769,232 L734Q probably damaging Het
Vmn1r167 G T 7: 23,504,779 H271N probably benign Het
Vmn2r76 A G 7: 86,230,246 V282A probably benign Het
Xirp2 A G 2: 67,513,939 K2175E probably benign Het
Other mutations in Tpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Tpr APN 1 150423696 splice site probably benign
IGL00424:Tpr APN 1 150398595 splice site probably benign
IGL01095:Tpr APN 1 150410140 missense possibly damaging 0.95
IGL01347:Tpr APN 1 150426987 missense probably damaging 1.00
IGL01519:Tpr APN 1 150431168 missense probably benign 0.01
IGL01768:Tpr APN 1 150444448 missense possibly damaging 0.85
IGL01939:Tpr APN 1 150413745 missense possibly damaging 0.82
IGL01988:Tpr APN 1 150426999 splice site probably null
IGL02065:Tpr APN 1 150413774 missense probably benign 0.13
IGL02110:Tpr APN 1 150435742 missense probably damaging 0.97
IGL02311:Tpr APN 1 150398653 missense probably damaging 0.97
IGL02454:Tpr APN 1 150431192 missense probably benign 0.00
IGL02569:Tpr APN 1 150425631 unclassified probably benign
IGL03168:Tpr APN 1 150408757 missense probably benign 0.04
IGL03193:Tpr APN 1 150440080 missense possibly damaging 0.85
IGL03333:Tpr APN 1 150426967 missense probably benign 0.04
gridiron UTSW 1 150423516 missense probably damaging 1.00
Pouch UTSW 1 150433772 missense probably damaging 1.00
punt UTSW 1 150418039 missense probably benign 0.02
Turf UTSW 1 150442245 critical splice donor site probably null
F6893:Tpr UTSW 1 150393562 missense possibly damaging 0.84
PIT4305001:Tpr UTSW 1 150440137 missense possibly damaging 0.85
PIT4469001:Tpr UTSW 1 150403956 missense probably benign 0.41
R0085:Tpr UTSW 1 150417413 missense possibly damaging 0.95
R0101:Tpr UTSW 1 150409302 splice site probably benign
R0116:Tpr UTSW 1 150410147 missense probably damaging 0.98
R0136:Tpr UTSW 1 150430595 missense probably benign 0.01
R0207:Tpr UTSW 1 150417427 missense possibly damaging 0.74
R0219:Tpr UTSW 1 150443258 splice site probably null
R0380:Tpr UTSW 1 150412947 missense probably benign 0.27
R0403:Tpr UTSW 1 150407414 splice site probably benign
R0469:Tpr UTSW 1 150423667 frame shift probably null
R0480:Tpr UTSW 1 150428241 missense possibly damaging 0.83
R0514:Tpr UTSW 1 150402273 missense possibly damaging 0.55
R0563:Tpr UTSW 1 150408858 missense probably benign 0.13
R0631:Tpr UTSW 1 150422531 missense probably damaging 0.98
R0685:Tpr UTSW 1 150433725 missense possibly damaging 0.69
R0730:Tpr UTSW 1 150393407 utr 5 prime probably benign
R0739:Tpr UTSW 1 150407497 missense possibly damaging 0.94
R0780:Tpr UTSW 1 150431341 missense probably benign 0.00
R1018:Tpr UTSW 1 150442183 missense possibly damaging 0.53
R1084:Tpr UTSW 1 150442161 missense probably benign 0.18
R1551:Tpr UTSW 1 150436801 missense probably benign 0.00
R1608:Tpr UTSW 1 150426893 missense probably damaging 0.96
R1759:Tpr UTSW 1 150429524 missense probably benign 0.19
R1817:Tpr UTSW 1 150419903 missense probably damaging 0.98
R1932:Tpr UTSW 1 150421663 missense probably benign 0.00
R1978:Tpr UTSW 1 150419907 missense possibly damaging 0.65
R2031:Tpr UTSW 1 150442119 missense probably benign
R2176:Tpr UTSW 1 150419940 missense possibly damaging 0.56
R2235:Tpr UTSW 1 150442092 missense probably benign 0.33
R2339:Tpr UTSW 1 150413774 missense probably benign 0.01
R2367:Tpr UTSW 1 150433728 missense probably damaging 0.99
R2507:Tpr UTSW 1 150392944 start codon destroyed probably null
R3931:Tpr UTSW 1 150435904 missense probably damaging 1.00
R4320:Tpr UTSW 1 150423574 missense possibly damaging 0.96
R4439:Tpr UTSW 1 150403961 missense probably benign 0.01
R4568:Tpr UTSW 1 150392959 unclassified probably benign
R4644:Tpr UTSW 1 150423499 missense probably benign 0.01
R4665:Tpr UTSW 1 150444399 missense probably damaging 0.97
R4672:Tpr UTSW 1 150423567 missense probably benign 0.45
R4673:Tpr UTSW 1 150423567 missense probably benign 0.45
R4735:Tpr UTSW 1 150442196 missense possibly damaging 0.91
R4767:Tpr UTSW 1 150430529 intron probably benign
R4772:Tpr UTSW 1 150413113 missense possibly damaging 0.46
R4815:Tpr UTSW 1 150398608 missense probably benign 0.01
R4839:Tpr UTSW 1 150449197 nonsense probably null
R4844:Tpr UTSW 1 150445879 missense possibly damaging 0.86
R4925:Tpr UTSW 1 150432565 missense probably benign 0.00
R4967:Tpr UTSW 1 150410059 missense probably damaging 0.99
R5017:Tpr UTSW 1 150398637 missense probably benign 0.00
R5096:Tpr UTSW 1 150446202 missense probably damaging 0.99
R5353:Tpr UTSW 1 150445924 missense probably damaging 1.00
R5354:Tpr UTSW 1 150445924 missense probably damaging 1.00
R5484:Tpr UTSW 1 150426888 missense probably benign 0.33
R5601:Tpr UTSW 1 150435853 missense possibly damaging 0.75
R5642:Tpr UTSW 1 150423818 missense probably damaging 0.99
R5779:Tpr UTSW 1 150423541 missense probably damaging 1.00
R5787:Tpr UTSW 1 150395286 missense probably benign 0.01
R5892:Tpr UTSW 1 150407400 missense probably benign 0.44
R5915:Tpr UTSW 1 150425649 missense probably benign 0.15
R5928:Tpr UTSW 1 150428127 missense probably benign 0.30
R6146:Tpr UTSW 1 150423162 missense possibly damaging 0.83
R6154:Tpr UTSW 1 150423816 missense probably benign 0.00
R6234:Tpr UTSW 1 150418039 missense probably benign 0.02
R6263:Tpr UTSW 1 150442245 critical splice donor site probably null
R6318:Tpr UTSW 1 150445888 missense possibly damaging 0.93
R6550:Tpr UTSW 1 150423977 missense probably damaging 1.00
R6592:Tpr UTSW 1 150411905 missense possibly damaging 0.83
R6704:Tpr UTSW 1 150406508 missense possibly damaging 0.80
R6716:Tpr UTSW 1 150414765 missense probably damaging 1.00
R6836:Tpr UTSW 1 150436673 splice site probably null
R6886:Tpr UTSW 1 150423965 missense probably benign 0.00
R6894:Tpr UTSW 1 150436847 missense probably benign 0.28
R6928:Tpr UTSW 1 150408785 missense possibly damaging 0.83
R7011:Tpr UTSW 1 150433772 missense probably damaging 1.00
R7034:Tpr UTSW 1 150423607 missense probably benign 0.02
R7036:Tpr UTSW 1 150423607 missense probably benign 0.02
R7183:Tpr UTSW 1 150406551 missense probably damaging 1.00
R7221:Tpr UTSW 1 150446178 missense possibly damaging 0.96
R7223:Tpr UTSW 1 150439256 missense possibly damaging 0.53
R7294:Tpr UTSW 1 150403887 missense probably damaging 1.00
R7343:Tpr UTSW 1 150393494 missense unknown
R7361:Tpr UTSW 1 150447621 missense possibly damaging 0.73
R7405:Tpr UTSW 1 150442127 missense probably benign 0.02
R7637:Tpr UTSW 1 150423516 missense probably damaging 1.00
R7720:Tpr UTSW 1 150429532 missense possibly damaging 0.49
R7721:Tpr UTSW 1 150444429 missense probably benign
R7751:Tpr UTSW 1 150419895 missense probably benign 0.17
R7804:Tpr UTSW 1 150432559 missense probably damaging 0.99
R7878:Tpr UTSW 1 150423660 missense possibly damaging 0.67
R7973:Tpr UTSW 1 150403887 missense probably damaging 1.00
R8013:Tpr UTSW 1 150398608 missense probably benign
R8220:Tpr UTSW 1 150432413 missense probably benign 0.05
R8274:Tpr UTSW 1 150423479 splice site probably benign
R8428:Tpr UTSW 1 150414813 missense probably damaging 1.00
R8482:Tpr UTSW 1 150433700 missense probably damaging 1.00
X0021:Tpr UTSW 1 150395207 missense probably damaging 1.00
Z1177:Tpr UTSW 1 150428235 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- aatagtggaagttggaaggagg -3'
Posted On2014-04-13