Mutagenetix > Incidental Mutations

Incidental Mutation 'R1532:Sele'

166624

Institutional Source

Beutler Lab

Gene Symbol

Sele

Ensembl Gene

ENSMUSG00000026582

Gene Name

selectin, endothelial cell

Synonyms

CD62E, E-selectin, Elam

MMRRC Submission

039571-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R1532 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

164048234-164057677 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 164053851 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 509 (K509R)

Ref Sequence

ENSEMBL: ENSMUSP00000027874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027874]

Predicted Effect

probably benign
Transcript: ENSMUST00000027874
AA Change: K509R

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000027874
Gene: ENSMUSG00000026582
AA Change: K509R

Domain	Start	End	E-Value	Type
CLECT	21	146	1.45e-21	SMART
EGF	149	182	2.83e-5	SMART
CCP	187	245	1.49e-9	SMART
CCP	250	307	5.43e-12	SMART
CCP	312	370	1.82e-13	SMART
CCP	375	433	1.36e-12	SMART
CCP	438	496	6e-14	SMART
CCP	501	555	1.39e-9	SMART
transmembrane domain	565	587	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in cytokine-stimulated endothelial cells and is thought to be responsible for the accumulation of blood leukocytes at sites of inflammation by mediating the adhesion of cells to the vascular lining. It exhibits structural features such as the presence of lectin- and EGF-like domains followed by short consensus repeat (SCR) domains that contain 6 conserved cysteine residues. These proteins are part of the selectin family of cell adhesion molecules. Adhesion molecules participate in the interaction between leukocytes and the endothelium and appear to be involved in the pathogenesis of atherosclerosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit mild defects in neutrophil infiltration during inflammatory responses. When combined with other selectin gene knockouts, more severe defects are present. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl1	C	A	4: 86,248,065	H394N	probably benign	Het
Ahrr	A	G	13: 74,213,707	S558P	probably benign	Het
Ankrd26	T	C	6: 118,522,958	N1184S	probably damaging	Het
Anpep	A	T	7: 79,826,948	C14*	probably null	Het
Arhgap18	A	G	10: 26,860,722	D187G	possibly damaging	Het
Arhgef5	A	G	6: 43,273,403	T363A	probably benign	Het
Atxn1	A	T	13: 45,566,910	L503Q	possibly damaging	Het
Babam1	A	G	8: 71,399,633	D155G	possibly damaging	Het
Bbs9	A	G	9: 22,887,649	T858A	probably benign	Het
Cacna1g	C	A	11: 94,443,331	G828V	probably damaging	Het
Ccar2	T	C	14: 70,142,956	T392A	probably benign	Het
Cd163	T	C	6: 124,312,730	V469A	possibly damaging	Het
Cdh23	G	T	10: 60,314,331	N2576K	probably damaging	Het
Coro2b	A	G	9: 62,489,423	Y18H	probably damaging	Het
Crispld2	G	T	8: 120,023,572	K238N	probably benign	Het
Ctnnd2	T	C	15: 30,921,868	I880T	probably damaging	Het
Cubn	C	A	2: 13,287,661	C3237F	probably damaging	Het
Ddx31	A	G	2: 28,881,159	M519V	probably benign	Het
Dhx32	A	T	7: 133,749,024	C106S	possibly damaging	Het
Diaph1	A	G	18: 37,896,093		probably null	Het
Dnaaf1	T	C	8: 119,577,423	F67L	probably benign	Het
Duox1	T	G	2: 122,344,723	L1334R	probably damaging	Het
Dync1li2	A	T	8: 104,426,035	I322N	probably damaging	Het
Eml6	T	C	11: 29,792,256		probably null	Het
Entpd6	A	G	2: 150,758,750	Q126R	probably benign	Het
Entpd7	C	G	19: 43,691,077	P23R	possibly damaging	Het
Epha3	T	C	16: 63,546,178	I970V	probably benign	Het
Fras1	A	T	5: 96,713,996	H2163L	probably damaging	Het
Gse1	C	G	8: 120,568,210		probably benign	Het
Heatr5a	A	G	12: 51,952,518	V300A	probably damaging	Het
Hsd3b1	T	A	3: 98,852,898	D259V	probably damaging	Het
Hspbap1	T	C	16: 35,825,303	S453P	probably damaging	Het
Ifnl3	A	G	7: 28,524,227	T163A	probably benign	Het
Igbp1b	T	A	6: 138,658,444	M1L	possibly damaging	Het
Klra3	G	C	6: 130,333,144	R138G	probably benign	Het
Lpxn	T	C	19: 12,804,092		probably null	Het
Mast1	G	A	8: 84,928,609	Q249*	probably null	Het
Mink1	A	G	11: 70,602,007	D153G	probably null	Het
Mllt10	G	A	2: 18,092,835		probably null	Het
Mpl	C	T	4: 118,448,568	G420E	possibly damaging	Het
Ms4a1	T	A	19: 11,253,193	T215S	probably benign	Het
Ncapd3	C	T	9: 27,083,360	Q1179*	probably null	Het
Nr3c2	A	G	8: 76,909,104	H278R	probably damaging	Het
Olfr1417	T	C	19: 11,828,619	I136V	probably benign	Het
Olfr1454	A	G	19: 13,064,275	Y288C	probably damaging	Het
Olfr670	T	C	7: 104,960,265	I156V	probably benign	Het
Os9	C	T	10: 127,098,902	V353M	probably damaging	Het
Osbpl5	A	T	7: 143,695,080	M589K	probably benign	Het
Phf20	G	T	2: 156,303,049	G859V	possibly damaging	Het
Pkhd1	G	A	1: 20,117,401	T3561I	probably benign	Het
Prss46	G	A	9: 110,850,168	V146I	probably benign	Het
Ptprk	G	A	10: 28,585,630	V1139M	probably damaging	Het
Ranbp10	A	G	8: 105,774,331	L396P	probably benign	Het
Rb1cc1	A	G	1: 6,249,734	T1126A	probably benign	Het
Rbl2	G	A	8: 91,106,417	A659T	probably benign	Het
Rdm1	T	C	11: 101,633,817	L192P	probably damaging	Het
Reln	A	C	5: 22,034,744	W842G	probably damaging	Het
Scn5a	C	T	9: 119,533,847	R569H	probably damaging	Het
Slc15a1	A	T	14: 121,475,984	I377N	possibly damaging	Het
Slc17a3	G	A	13: 23,856,500	G269D	probably damaging	Het
Slc35a5	T	C	16: 45,151,557	T115A	probably benign	Het
Slc5a12	T	G	2: 110,610,138	N157K	possibly damaging	Het
Sphkap	A	G	1: 83,257,203	V1634A	probably damaging	Het
Spta1	T	C	1: 174,247,353	S2382P	probably damaging	Het
Synj2	C	A	17: 6,033,919	S1100R	probably benign	Het
Tcf23	A	G	5: 30,973,557	T180A	probably benign	Het
Tnxb	T	C	17: 34,710,830	V2846A	probably damaging	Het
Tpr	T	A	1: 150,418,000	I915K	probably damaging	Het
Uba1y	C	T	Y: 828,862	H557Y	probably benign	Het
Unc45b	T	A	11: 82,936,874	D730E	probably benign	Het
Unc5b	A	T	10: 60,769,232	L734Q	probably damaging	Het
Vmn1r167	G	T	7: 23,504,779	H271N	probably benign	Het
Vmn2r76	A	G	7: 86,230,246	V282A	probably benign	Het
Xirp2	A	G	2: 67,513,939	K2175E	probably benign	Het

Other mutations in Sele

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Sele	APN	1	164051834	missense	probably damaging	1.00
IGL02097:Sele	APN	1	164053093	missense	probably benign	0.02
IGL02243:Sele	APN	1	164052968	missense	probably benign	0.01
IGL02688:Sele	APN	1	164050130	missense	probably damaging	1.00
IGL03022:Sele	APN	1	164054679	missense	probably benign	0.01
R0433:Sele	UTSW	1	164049244	missense	possibly damaging	0.74
R0487:Sele	UTSW	1	164053615	nonsense	probably null
R0678:Sele	UTSW	1	164054729	critical splice donor site	probably null
R1295:Sele	UTSW	1	164050810	missense	probably damaging	1.00
R1296:Sele	UTSW	1	164050810	missense	probably damaging	1.00
R1730:Sele	UTSW	1	164054623	missense	probably benign
R2102:Sele	UTSW	1	164053826	missense	probably damaging	1.00
R2384:Sele	UTSW	1	164050775	missense	probably benign	0.00
R3001:Sele	UTSW	1	164053571	missense	probably damaging	1.00
R3002:Sele	UTSW	1	164053571	missense	probably damaging	1.00
R5851:Sele	UTSW	1	164049574	missense	probably benign	0.06
R6164:Sele	UTSW	1	164051817	splice site	probably null
R6239:Sele	UTSW	1	164050808	missense	probably damaging	0.98
R6406:Sele	UTSW	1	164050743	missense	probably damaging	1.00
R6411:Sele	UTSW	1	164049415	missense	probably benign	0.03
R6731:Sele	UTSW	1	164053673	missense	probably damaging	1.00
R6851:Sele	UTSW	1	164053952	missense	probably damaging	1.00
R7291:Sele	UTSW	1	164053868	missense	possibly damaging	0.89
R7328:Sele	UTSW	1	164049275	missense	probably benign	0.23
R7366:Sele	UTSW	1	164048719	missense	probably benign	0.00
R7393:Sele	UTSW	1	164053923	missense	probably benign	0.05
R7431:Sele	UTSW	1	164051620	missense	probably damaging	0.99
R7603:Sele	UTSW	1	164049515	missense	probably damaging	1.00
R7803:Sele	UTSW	1	164050694	missense	possibly damaging	0.88
R7807:Sele	UTSW	1	164053893	missense	probably benign	0.05
R8323:Sele	UTSW	1	164051638	missense	possibly damaging	0.59
X0005:Sele	UTSW	1	164049343	missense	probably damaging	1.00
X0021:Sele	UTSW	1	164053611	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- ACATCTCAGGGAAAGTGGACCCAG -3'
(R):5'- TGGCACTACGTCACGTCACCATAC -3'

Sequencing Primer
(F):5'- AGTGGACCCAGGAAGTCCC -3'
(R):5'- ATGACCTACCATTCTGATTTGGAC -3'

Posted On

2014-04-13