Incidental Mutation 'R1532:Hsd3b1'
ID166636
Institutional Source Beutler Lab
Gene Symbol Hsd3b1
Ensembl Gene ENSMUSG00000027871
Gene Namehydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
SynonymsD3Ertd383e
MMRRC Submission 039571-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R1532 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location98852194-98859794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98852898 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 259 (D259V)
Ref Sequence ENSEMBL: ENSMUSP00000102630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029465] [ENSMUST00000107016]
Predicted Effect probably damaging
Transcript: ENSMUST00000029465
AA Change: D259V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029465
Gene: ENSMUSG00000027871
AA Change: D259V

DomainStartEndE-ValueType
Pfam:Epimerase 24 248 3.8e-23 PFAM
Pfam:NAD_binding_4 25 226 3.4e-18 PFAM
Pfam:Polysacc_synt_2 30 129 1.3e-8 PFAM
Pfam:3Beta_HSD 34 282 1.8e-102 PFAM
Pfam:NAD_binding_10 35 228 1.7e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107016
AA Change: D259V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102630
Gene: ENSMUSG00000027871
AA Change: D259V

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 264 4.3e-8 PFAM
Pfam:KR 5 133 1.1e-7 PFAM
Pfam:Ldh_1_N 5 135 4.3e-7 PFAM
Pfam:Polysacc_synt_2 6 136 3e-14 PFAM
Pfam:NmrA 6 138 6.2e-10 PFAM
Pfam:Epimerase 6 250 2.9e-30 PFAM
Pfam:GDP_Man_Dehyd 7 216 6.6e-16 PFAM
Pfam:3Beta_HSD 7 288 2.1e-122 PFAM
Pfam:NAD_binding_4 8 219 4e-21 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that catalyzes the oxidative conversion of delta(5)-ene-3-beta-hydroxy steroid, and the oxidative conversion of ketosteroids. It plays a crucial role in the biosynthesis of all classes of hormonal steroids. This gene is predominantly expressed in the adrenals and the gonads. Mutations in this gene are associated with 3-beta-hydroxysteroid dehydrogenase, type II, deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 C A 4: 86,248,065 H394N probably benign Het
Ahrr A G 13: 74,213,707 S558P probably benign Het
Ankrd26 T C 6: 118,522,958 N1184S probably damaging Het
Anpep A T 7: 79,826,948 C14* probably null Het
Arhgap18 A G 10: 26,860,722 D187G possibly damaging Het
Arhgef5 A G 6: 43,273,403 T363A probably benign Het
Atxn1 A T 13: 45,566,910 L503Q possibly damaging Het
Babam1 A G 8: 71,399,633 D155G possibly damaging Het
Bbs9 A G 9: 22,887,649 T858A probably benign Het
Cacna1g C A 11: 94,443,331 G828V probably damaging Het
Ccar2 T C 14: 70,142,956 T392A probably benign Het
Cd163 T C 6: 124,312,730 V469A possibly damaging Het
Cdh23 G T 10: 60,314,331 N2576K probably damaging Het
Coro2b A G 9: 62,489,423 Y18H probably damaging Het
Crispld2 G T 8: 120,023,572 K238N probably benign Het
Ctnnd2 T C 15: 30,921,868 I880T probably damaging Het
Cubn C A 2: 13,287,661 C3237F probably damaging Het
Ddx31 A G 2: 28,881,159 M519V probably benign Het
Dhx32 A T 7: 133,749,024 C106S possibly damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Dnaaf1 T C 8: 119,577,423 F67L probably benign Het
Duox1 T G 2: 122,344,723 L1334R probably damaging Het
Dync1li2 A T 8: 104,426,035 I322N probably damaging Het
Eml6 T C 11: 29,792,256 probably null Het
Entpd6 A G 2: 150,758,750 Q126R probably benign Het
Entpd7 C G 19: 43,691,077 P23R possibly damaging Het
Epha3 T C 16: 63,546,178 I970V probably benign Het
Fras1 A T 5: 96,713,996 H2163L probably damaging Het
Gse1 C G 8: 120,568,210 probably benign Het
Heatr5a A G 12: 51,952,518 V300A probably damaging Het
Hspbap1 T C 16: 35,825,303 S453P probably damaging Het
Ifnl3 A G 7: 28,524,227 T163A probably benign Het
Igbp1b T A 6: 138,658,444 M1L possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lpxn T C 19: 12,804,092 probably null Het
Mast1 G A 8: 84,928,609 Q249* probably null Het
Mink1 A G 11: 70,602,007 D153G probably null Het
Mllt10 G A 2: 18,092,835 probably null Het
Mpl C T 4: 118,448,568 G420E possibly damaging Het
Ms4a1 T A 19: 11,253,193 T215S probably benign Het
Ncapd3 C T 9: 27,083,360 Q1179* probably null Het
Nr3c2 A G 8: 76,909,104 H278R probably damaging Het
Olfr1417 T C 19: 11,828,619 I136V probably benign Het
Olfr1454 A G 19: 13,064,275 Y288C probably damaging Het
Olfr670 T C 7: 104,960,265 I156V probably benign Het
Os9 C T 10: 127,098,902 V353M probably damaging Het
Osbpl5 A T 7: 143,695,080 M589K probably benign Het
Phf20 G T 2: 156,303,049 G859V possibly damaging Het
Pkhd1 G A 1: 20,117,401 T3561I probably benign Het
Prss46 G A 9: 110,850,168 V146I probably benign Het
Ptprk G A 10: 28,585,630 V1139M probably damaging Het
Ranbp10 A G 8: 105,774,331 L396P probably benign Het
Rb1cc1 A G 1: 6,249,734 T1126A probably benign Het
Rbl2 G A 8: 91,106,417 A659T probably benign Het
Rdm1 T C 11: 101,633,817 L192P probably damaging Het
Reln A C 5: 22,034,744 W842G probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sele A G 1: 164,053,851 K509R probably benign Het
Slc15a1 A T 14: 121,475,984 I377N possibly damaging Het
Slc17a3 G A 13: 23,856,500 G269D probably damaging Het
Slc35a5 T C 16: 45,151,557 T115A probably benign Het
Slc5a12 T G 2: 110,610,138 N157K possibly damaging Het
Sphkap A G 1: 83,257,203 V1634A probably damaging Het
Spta1 T C 1: 174,247,353 S2382P probably damaging Het
Synj2 C A 17: 6,033,919 S1100R probably benign Het
Tcf23 A G 5: 30,973,557 T180A probably benign Het
Tnxb T C 17: 34,710,830 V2846A probably damaging Het
Tpr T A 1: 150,418,000 I915K probably damaging Het
Uba1y C T Y: 828,862 H557Y probably benign Het
Unc45b T A 11: 82,936,874 D730E probably benign Het
Unc5b A T 10: 60,769,232 L734Q probably damaging Het
Vmn1r167 G T 7: 23,504,779 H271N probably benign Het
Vmn2r76 A G 7: 86,230,246 V282A probably benign Het
Xirp2 A G 2: 67,513,939 K2175E probably benign Het
Other mutations in Hsd3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Hsd3b1 APN 3 98853246 missense probably damaging 1.00
IGL01955:Hsd3b1 APN 3 98853147 missense probably benign 0.08
IGL02894:Hsd3b1 APN 3 98852929 missense possibly damaging 0.88
IGL03136:Hsd3b1 APN 3 98852985 missense probably damaging 1.00
R0265:Hsd3b1 UTSW 3 98852773 missense probably damaging 1.00
R0326:Hsd3b1 UTSW 3 98853274 missense probably damaging 1.00
R0390:Hsd3b1 UTSW 3 98853039 missense probably damaging 1.00
R2845:Hsd3b1 UTSW 3 98852778 missense probably damaging 1.00
R2846:Hsd3b1 UTSW 3 98852778 missense probably damaging 1.00
R2898:Hsd3b1 UTSW 3 98853307 missense probably benign 0.00
R3153:Hsd3b1 UTSW 3 98852664 missense probably damaging 0.99
R3950:Hsd3b1 UTSW 3 98856138 missense possibly damaging 0.79
R4456:Hsd3b1 UTSW 3 98856143 missense probably benign 0.01
R4792:Hsd3b1 UTSW 3 98852910 missense probably benign 0.22
R4799:Hsd3b1 UTSW 3 98852865 missense probably benign 0.07
R4898:Hsd3b1 UTSW 3 98853326 missense probably benign 0.12
R5512:Hsd3b1 UTSW 3 98853205 missense probably benign 0.06
R5834:Hsd3b1 UTSW 3 98852939 missense possibly damaging 0.60
R5921:Hsd3b1 UTSW 3 98857899 missense probably benign 0.06
R6221:Hsd3b1 UTSW 3 98853156 missense probably benign 0.00
R6918:Hsd3b1 UTSW 3 98853109 missense probably damaging 0.98
R7058:Hsd3b1 UTSW 3 98857815 splice site probably null
R7242:Hsd3b1 UTSW 3 98853210 missense probably damaging 1.00
R8181:Hsd3b1 UTSW 3 98856137 missense probably damaging 1.00
R8187:Hsd3b1 UTSW 3 98852617 missense probably damaging 1.00
R8237:Hsd3b1 UTSW 3 98853110 missense possibly damaging 0.65
Z1176:Hsd3b1 UTSW 3 98852886 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGACTGGACGTAGCAGGAAGCTC -3'
(R):5'- AGCAAGTGTGCCAGCCTTCATC -3'

Sequencing Primer
(F):5'- AGCTCACAGTTTCCAGCAGG -3'
(R):5'- TCGTACAAGAAGATCGTCCTG -3'
Posted On2014-04-13