Mutagenetix > Incidental Mutations

Incidental Mutation 'R1532:Anpep'

166650

Institutional Source

Beutler Lab

Gene Symbol

Anpep

Ensembl Gene

ENSMUSG00000039062

Gene Name

alanyl (membrane) aminopeptidase

Synonyms

aminopeptidase N, Cd13, Apn

MMRRC Submission

039571-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1532 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79821803-79861059 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 79826948 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 14 (C14*)

Ref Sequence

ENSEMBL: ENSMUSP00000145682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049004] [ENSMUST00000107392] [ENSMUST00000205502]

Predicted Effect

probably null
Transcript: ENSMUST00000049004
AA Change: C760*

SMART Domains

Protein: ENSMUSP00000035943
Gene: ENSMUSG00000039062
AA Change: C760*

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	44	64	N/A	INTRINSIC
Pfam:Peptidase_M1	75	479	6.3e-142	PFAM
Pfam:Peptidase_MA_2	355	502	1.4e-21	PFAM
Pfam:ERAP1_C	618	944	2.9e-45	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000107392
AA Change: C760*

SMART Domains

Protein: ENSMUSP00000103015
Gene: ENSMUSG00000039062
AA Change: C760*

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	44	64	N/A	INTRINSIC
Pfam:Peptidase_M1	75	479	2.5e-139	PFAM
Pfam:ERAP1_C	618	943	2e-73	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000205502
AA Change: C14*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206387

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206682

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminopeptidase N is located in the small-intestinal and renal microvillar membrane, and also in other plasma membranes. In the small intestine aminopeptidase N plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Its function in proximal tubular epithelial cells and other cell types is less clear. The large extracellular carboxyterminal domain contains a pentapeptide consensus sequence characteristic of members of the zinc-binding metalloproteinase superfamily. Sequence comparisons with known enzymes of this class showed that CD13 and aminopeptidase N are identical. The latter enzyme was thought to be involved in the metabolism of regulatory peptides by diverse cell types, including small intestinal and renal tubular epithelial cells, macrophages, granulocytes, and synaptic membranes from the CNS. Human aminopeptidase N is a receptor for one strain of human coronavirus that is an important cause of upper respiratory tract infections. Defects in this gene appear to be a cause of various types of leukemia or lymphoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for different knock-out alleles exhibit an increase in CD4+ thymocytes, altered macrophage adhesion, pathological neovascularization and/or altered mammary gland morphology during gestation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl1	C	A	4: 86,248,065	H394N	probably benign	Het
Ahrr	A	G	13: 74,213,707	S558P	probably benign	Het
Ankrd26	T	C	6: 118,522,958	N1184S	probably damaging	Het
Arhgap18	A	G	10: 26,860,722	D187G	possibly damaging	Het
Arhgef5	A	G	6: 43,273,403	T363A	probably benign	Het
Atxn1	A	T	13: 45,566,910	L503Q	possibly damaging	Het
Babam1	A	G	8: 71,399,633	D155G	possibly damaging	Het
Bbs9	A	G	9: 22,887,649	T858A	probably benign	Het
Cacna1g	C	A	11: 94,443,331	G828V	probably damaging	Het
Ccar2	T	C	14: 70,142,956	T392A	probably benign	Het
Cd163	T	C	6: 124,312,730	V469A	possibly damaging	Het
Cdh23	G	T	10: 60,314,331	N2576K	probably damaging	Het
Coro2b	A	G	9: 62,489,423	Y18H	probably damaging	Het
Crispld2	G	T	8: 120,023,572	K238N	probably benign	Het
Ctnnd2	T	C	15: 30,921,868	I880T	probably damaging	Het
Cubn	C	A	2: 13,287,661	C3237F	probably damaging	Het
Ddx31	A	G	2: 28,881,159	M519V	probably benign	Het
Dhx32	A	T	7: 133,749,024	C106S	possibly damaging	Het
Diaph1	A	G	18: 37,896,093		probably null	Het
Dnaaf1	T	C	8: 119,577,423	F67L	probably benign	Het
Duox1	T	G	2: 122,344,723	L1334R	probably damaging	Het
Dync1li2	A	T	8: 104,426,035	I322N	probably damaging	Het
Eml6	T	C	11: 29,792,256		probably null	Het
Entpd6	A	G	2: 150,758,750	Q126R	probably benign	Het
Entpd7	C	G	19: 43,691,077	P23R	possibly damaging	Het
Epha3	T	C	16: 63,546,178	I970V	probably benign	Het
Fras1	A	T	5: 96,713,996	H2163L	probably damaging	Het
Gse1	C	G	8: 120,568,210		probably benign	Het
Heatr5a	A	G	12: 51,952,518	V300A	probably damaging	Het
Hsd3b1	T	A	3: 98,852,898	D259V	probably damaging	Het
Hspbap1	T	C	16: 35,825,303	S453P	probably damaging	Het
Ifnl3	A	G	7: 28,524,227	T163A	probably benign	Het
Igbp1b	T	A	6: 138,658,444	M1L	possibly damaging	Het
Klra3	G	C	6: 130,333,144	R138G	probably benign	Het
Lpxn	T	C	19: 12,804,092		probably null	Het
Mast1	G	A	8: 84,928,609	Q249*	probably null	Het
Mink1	A	G	11: 70,602,007	D153G	probably null	Het
Mllt10	G	A	2: 18,092,835		probably null	Het
Mpl	C	T	4: 118,448,568	G420E	possibly damaging	Het
Ms4a1	T	A	19: 11,253,193	T215S	probably benign	Het
Ncapd3	C	T	9: 27,083,360	Q1179*	probably null	Het
Nr3c2	A	G	8: 76,909,104	H278R	probably damaging	Het
Olfr1417	T	C	19: 11,828,619	I136V	probably benign	Het
Olfr1454	A	G	19: 13,064,275	Y288C	probably damaging	Het
Olfr670	T	C	7: 104,960,265	I156V	probably benign	Het
Os9	C	T	10: 127,098,902	V353M	probably damaging	Het
Osbpl5	A	T	7: 143,695,080	M589K	probably benign	Het
Phf20	G	T	2: 156,303,049	G859V	possibly damaging	Het
Pkhd1	G	A	1: 20,117,401	T3561I	probably benign	Het
Prss46	G	A	9: 110,850,168	V146I	probably benign	Het
Ptprk	G	A	10: 28,585,630	V1139M	probably damaging	Het
Ranbp10	A	G	8: 105,774,331	L396P	probably benign	Het
Rb1cc1	A	G	1: 6,249,734	T1126A	probably benign	Het
Rbl2	G	A	8: 91,106,417	A659T	probably benign	Het
Rdm1	T	C	11: 101,633,817	L192P	probably damaging	Het
Reln	A	C	5: 22,034,744	W842G	probably damaging	Het
Scn5a	C	T	9: 119,533,847	R569H	probably damaging	Het
Sele	A	G	1: 164,053,851	K509R	probably benign	Het
Slc15a1	A	T	14: 121,475,984	I377N	possibly damaging	Het
Slc17a3	G	A	13: 23,856,500	G269D	probably damaging	Het
Slc35a5	T	C	16: 45,151,557	T115A	probably benign	Het
Slc5a12	T	G	2: 110,610,138	N157K	possibly damaging	Het
Sphkap	A	G	1: 83,257,203	V1634A	probably damaging	Het
Spta1	T	C	1: 174,247,353	S2382P	probably damaging	Het
Synj2	C	A	17: 6,033,919	S1100R	probably benign	Het
Tcf23	A	G	5: 30,973,557	T180A	probably benign	Het
Tnxb	T	C	17: 34,710,830	V2846A	probably damaging	Het
Tpr	T	A	1: 150,418,000	I915K	probably damaging	Het
Uba1y	C	T	Y: 828,862	H557Y	probably benign	Het
Unc45b	T	A	11: 82,936,874	D730E	probably benign	Het
Unc5b	A	T	10: 60,769,232	L734Q	probably damaging	Het
Vmn1r167	G	T	7: 23,504,779	H271N	probably benign	Het
Vmn2r76	A	G	7: 86,230,246	V282A	probably benign	Het
Xirp2	A	G	2: 67,513,939	K2175E	probably benign	Het

Other mutations in Anpep

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Anpep	APN	7	79825736	missense	possibly damaging	0.64
IGL00089:Anpep	APN	7	79841986	missense	probably damaging	1.00
IGL00767:Anpep	APN	7	79840890	missense	probably benign	0.00
IGL00901:Anpep	APN	7	79839423	missense	probably benign
IGL01919:Anpep	APN	7	79825350	missense	possibly damaging	0.77
IGL02049:Anpep	APN	7	79835181	missense	probably damaging	0.97
IGL02195:Anpep	APN	7	79826685	missense	probably damaging	1.00
IGL02210:Anpep	APN	7	79826904	missense	probably benign	0.00
IGL02584:Anpep	APN	7	79825393	splice site	probably benign
IGL02677:Anpep	APN	7	79838730	missense	probably damaging	1.00
IGL03073:Anpep	APN	7	79838955	missense	probably damaging	1.00
IGL03100:Anpep	APN	7	79836361	missense	probably benign	0.01
PIT4696001:Anpep	UTSW	7	79839464	missense	possibly damaging	0.85
R0329:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R0330:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R0619:Anpep	UTSW	7	79841009	missense	probably benign
R0691:Anpep	UTSW	7	79839299	missense	probably damaging	0.98
R1004:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1005:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1274:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1288:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1289:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1540:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1574:Anpep	UTSW	7	79838407	splice site	probably null
R1574:Anpep	UTSW	7	79838407	splice site	probably null
R1618:Anpep	UTSW	7	79835417	missense	probably benign	0.00
R1627:Anpep	UTSW	7	79842011	missense	probably benign
R1693:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1717:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1745:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1746:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1748:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1809:Anpep	UTSW	7	79841823	missense	probably benign	0.01
R1901:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1902:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1903:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1985:Anpep	UTSW	7	79840857	splice site	probably null
R2379:Anpep	UTSW	7	79841218	missense	probably benign	0.28
R2508:Anpep	UTSW	7	79838291	missense	possibly damaging	0.80
R3110:Anpep	UTSW	7	79841972	missense	probably benign	0.15
R3112:Anpep	UTSW	7	79841972	missense	probably benign	0.15
R3898:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R3899:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R3900:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R4211:Anpep	UTSW	7	79840996	nonsense	probably null
R4701:Anpep	UTSW	7	79839465	missense	probably benign	0.16
R4716:Anpep	UTSW	7	79826632	missense	probably benign	0.00
R5020:Anpep	UTSW	7	79833727	missense	probably benign
R5042:Anpep	UTSW	7	79839469	missense	probably benign	0.00
R5084:Anpep	UTSW	7	79826870	critical splice donor site	probably null
R5319:Anpep	UTSW	7	79841731	missense	probably benign
R5593:Anpep	UTSW	7	79842046	missense	probably benign	0.04
R5778:Anpep	UTSW	7	79836391	missense	probably benign	0.00
R5852:Anpep	UTSW	7	79838972	nonsense	probably null
R5906:Anpep	UTSW	7	79833675	missense	probably benign
R6164:Anpep	UTSW	7	79842205	missense	possibly damaging	0.68
R6254:Anpep	UTSW	7	79839233	missense	probably damaging	1.00
R6284:Anpep	UTSW	7	79825802	missense	probably damaging	1.00
R6380:Anpep	UTSW	7	79841896	missense	probably benign	0.04
R6594:Anpep	UTSW	7	79841361	splice site	probably null
R6746:Anpep	UTSW	7	79839185	splice site	probably null
R6920:Anpep	UTSW	7	79825349	missense	probably damaging	1.00
R7060:Anpep	UTSW	7	79841794	missense	probably benign	0.33
R7072:Anpep	UTSW	7	79835379	missense	possibly damaging	0.58
R7095:Anpep	UTSW	7	79842202	missense	possibly damaging	0.87
R7102:Anpep	UTSW	7	79836313	missense	probably benign	0.00
R7178:Anpep	UTSW	7	79840988	missense	probably benign
R7223:Anpep	UTSW	7	79825310	missense	probably damaging	1.00
R7344:Anpep	UTSW	7	79838650	missense	possibly damaging	0.60
R7441:Anpep	UTSW	7	79827644	missense	possibly damaging	0.93
R7479:Anpep	UTSW	7	79835370	missense	probably benign	0.11
R7503:Anpep	UTSW	7	79826637	missense	probably damaging	1.00
R7683:Anpep	UTSW	7	79839198	missense	probably damaging	0.98
R7912:Anpep	UTSW	7	79838426	missense	probably benign	0.00
R7935:Anpep	UTSW	7	79826961	missense	possibly damaging	0.46
R8036:Anpep	UTSW	7	79841898	missense	probably benign	0.11
R8039:Anpep	UTSW	7	79839400	critical splice donor site	probably null
R8470:Anpep	UTSW	7	79839521	missense	probably benign	0.16
R8549:Anpep	UTSW	7	79840896	missense	probably benign	0.00
Z1176:Anpep	UTSW	7	79827639	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- CTCTTCTTCGCCACCGAAAGCAATG -3'
(R):5'- AAGCCCAAAGCTGCCTTGGGAAAC -3'

Sequencing Primer
(F):5'- GATCCTGGAGCGGCAAG -3'
(R):5'- GTGCAGGCCAATGGCAG -3'

Posted On

2014-04-13