Mutagenetix > Incidental Mutations

Incidental Mutation 'R1532:Dhx32'

166653

Institutional Source

Beutler Lab

Gene Symbol

Dhx32

Ensembl Gene

ENSMUSG00000030986

Gene Name

DEAH (Asp-Glu-Ala-His) box polypeptide 32

Synonyms

Ddx32

MMRRC Submission

039571-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.132) question?

Stock #

R1532 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

133720942-133782726 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 133749024 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 106 (C106S)

Ref Sequence

ENSEMBL: ENSMUSP00000066067 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033290] [ENSMUST00000063669] [ENSMUST00000106139] [ENSMUST00000130182] [ENSMUST00000149876]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033290
AA Change: C106S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000033290
Gene: ENSMUSG00000030986
AA Change: C106S

Domain	Start	End	E-Value	Type
Blast:DEXDc	67	253	1e-107	BLAST
SCOP:d1jpna2	77	289	9e-21	SMART
HA2	465	556	3.35e-21	SMART
Pfam:OB_NTP_bind	597	704	1.7e-17	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000063669
AA Change: C106S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000066067
Gene: ENSMUSG00000030986
AA Change: C106S

Domain	Start	End	E-Value	Type
Blast:DEXDc	67	253	1e-107	BLAST
SCOP:d1jpna2	77	289	9e-21	SMART
HA2	465	556	3.35e-21	SMART
Pfam:OB_NTP_bind	594	704	4.6e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106139

SMART Domains

Protein: ENSMUSP00000101745
Gene: ENSMUSG00000030986

Domain	Start	End	E-Value	Type
Blast:DEXDc	1	113	5e-54	BLAST
SCOP:d1jpna2	1	149	6e-11	SMART
HA2	325	416	3.35e-21	SMART
Pfam:OB_NTP_bind	457	564	1.2e-17	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000130182
AA Change: C106S

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000115677
Gene: ENSMUSG00000030986
AA Change: C106S

Domain	Start	End	E-Value	Type
PDB:3KX2\|A	42	106	8e-11	PDB
Blast:DEXDc	67	110	2e-22	BLAST
SCOP:d1jpna2	77	109	1e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140593

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146211

Predicted Effect

probably benign
Transcript: ENSMUST00000149876

SMART Domains

Protein: ENSMUSP00000121789
Gene: ENSMUSG00000030986

Domain	Start	End	E-Value	Type
PDB:3KX2\|A	42	142	7e-19	PDB
Blast:DEXDc	67	143	6e-42	BLAST
SCOP:d1a1va1	82	143	3e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211382

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211450

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates 2 transcript variants, but the full length nature of one of the variants has not been defined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl1	C	A	4: 86,248,065	H394N	probably benign	Het
Ahrr	A	G	13: 74,213,707	S558P	probably benign	Het
Ankrd26	T	C	6: 118,522,958	N1184S	probably damaging	Het
Anpep	A	T	7: 79,826,948	C14*	probably null	Het
Arhgap18	A	G	10: 26,860,722	D187G	possibly damaging	Het
Arhgef5	A	G	6: 43,273,403	T363A	probably benign	Het
Atxn1	A	T	13: 45,566,910	L503Q	possibly damaging	Het
Babam1	A	G	8: 71,399,633	D155G	possibly damaging	Het
Bbs9	A	G	9: 22,887,649	T858A	probably benign	Het
Cacna1g	C	A	11: 94,443,331	G828V	probably damaging	Het
Ccar2	T	C	14: 70,142,956	T392A	probably benign	Het
Cd163	T	C	6: 124,312,730	V469A	possibly damaging	Het
Cdh23	G	T	10: 60,314,331	N2576K	probably damaging	Het
Coro2b	A	G	9: 62,489,423	Y18H	probably damaging	Het
Crispld2	G	T	8: 120,023,572	K238N	probably benign	Het
Ctnnd2	T	C	15: 30,921,868	I880T	probably damaging	Het
Cubn	C	A	2: 13,287,661	C3237F	probably damaging	Het
Ddx31	A	G	2: 28,881,159	M519V	probably benign	Het
Diaph1	A	G	18: 37,896,093		probably null	Het
Dnaaf1	T	C	8: 119,577,423	F67L	probably benign	Het
Duox1	T	G	2: 122,344,723	L1334R	probably damaging	Het
Dync1li2	A	T	8: 104,426,035	I322N	probably damaging	Het
Eml6	T	C	11: 29,792,256		probably null	Het
Entpd6	A	G	2: 150,758,750	Q126R	probably benign	Het
Entpd7	C	G	19: 43,691,077	P23R	possibly damaging	Het
Epha3	T	C	16: 63,546,178	I970V	probably benign	Het
Fras1	A	T	5: 96,713,996	H2163L	probably damaging	Het
Gse1	C	G	8: 120,568,210		probably benign	Het
Heatr5a	A	G	12: 51,952,518	V300A	probably damaging	Het
Hsd3b1	T	A	3: 98,852,898	D259V	probably damaging	Het
Hspbap1	T	C	16: 35,825,303	S453P	probably damaging	Het
Ifnl3	A	G	7: 28,524,227	T163A	probably benign	Het
Igbp1b	T	A	6: 138,658,444	M1L	possibly damaging	Het
Klra3	G	C	6: 130,333,144	R138G	probably benign	Het
Lpxn	T	C	19: 12,804,092		probably null	Het
Mast1	G	A	8: 84,928,609	Q249*	probably null	Het
Mink1	A	G	11: 70,602,007	D153G	probably null	Het
Mllt10	G	A	2: 18,092,835		probably null	Het
Mpl	C	T	4: 118,448,568	G420E	possibly damaging	Het
Ms4a1	T	A	19: 11,253,193	T215S	probably benign	Het
Ncapd3	C	T	9: 27,083,360	Q1179*	probably null	Het
Nr3c2	A	G	8: 76,909,104	H278R	probably damaging	Het
Olfr1417	T	C	19: 11,828,619	I136V	probably benign	Het
Olfr1454	A	G	19: 13,064,275	Y288C	probably damaging	Het
Olfr670	T	C	7: 104,960,265	I156V	probably benign	Het
Os9	C	T	10: 127,098,902	V353M	probably damaging	Het
Osbpl5	A	T	7: 143,695,080	M589K	probably benign	Het
Phf20	G	T	2: 156,303,049	G859V	possibly damaging	Het
Pkhd1	G	A	1: 20,117,401	T3561I	probably benign	Het
Prss46	G	A	9: 110,850,168	V146I	probably benign	Het
Ptprk	G	A	10: 28,585,630	V1139M	probably damaging	Het
Ranbp10	A	G	8: 105,774,331	L396P	probably benign	Het
Rb1cc1	A	G	1: 6,249,734	T1126A	probably benign	Het
Rbl2	G	A	8: 91,106,417	A659T	probably benign	Het
Rdm1	T	C	11: 101,633,817	L192P	probably damaging	Het
Reln	A	C	5: 22,034,744	W842G	probably damaging	Het
Scn5a	C	T	9: 119,533,847	R569H	probably damaging	Het
Sele	A	G	1: 164,053,851	K509R	probably benign	Het
Slc15a1	A	T	14: 121,475,984	I377N	possibly damaging	Het
Slc17a3	G	A	13: 23,856,500	G269D	probably damaging	Het
Slc35a5	T	C	16: 45,151,557	T115A	probably benign	Het
Slc5a12	T	G	2: 110,610,138	N157K	possibly damaging	Het
Sphkap	A	G	1: 83,257,203	V1634A	probably damaging	Het
Spta1	T	C	1: 174,247,353	S2382P	probably damaging	Het
Synj2	C	A	17: 6,033,919	S1100R	probably benign	Het
Tcf23	A	G	5: 30,973,557	T180A	probably benign	Het
Tnxb	T	C	17: 34,710,830	V2846A	probably damaging	Het
Tpr	T	A	1: 150,418,000	I915K	probably damaging	Het
Uba1y	C	T	Y: 828,862	H557Y	probably benign	Het
Unc45b	T	A	11: 82,936,874	D730E	probably benign	Het
Unc5b	A	T	10: 60,769,232	L734Q	probably damaging	Het
Vmn1r167	G	T	7: 23,504,779	H271N	probably benign	Het
Vmn2r76	A	G	7: 86,230,246	V282A	probably benign	Het
Xirp2	A	G	2: 67,513,939	K2175E	probably benign	Het

Other mutations in Dhx32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01444:Dhx32	APN	7	133748977	missense	possibly damaging	0.76
IGL03398:Dhx32	APN	7	133759525	missense	probably damaging	1.00
R0729:Dhx32	UTSW	7	133737421	missense	probably benign	0.01
R1054:Dhx32	UTSW	7	133725272	missense	probably damaging	1.00
R1438:Dhx32	UTSW	7	133737340	missense	possibly damaging	0.87
R1864:Dhx32	UTSW	7	133737296	missense	probably benign	0.00
R1865:Dhx32	UTSW	7	133737296	missense	probably benign	0.00
R2074:Dhx32	UTSW	7	133721292	missense	probably benign	0.04
R2075:Dhx32	UTSW	7	133721292	missense	probably benign	0.04
R2119:Dhx32	UTSW	7	133722247	nonsense	probably null
R2377:Dhx32	UTSW	7	133724478	missense	probably damaging	1.00
R3125:Dhx32	UTSW	7	133725356	missense	probably damaging	1.00
R4519:Dhx32	UTSW	7	133734109	missense	probably damaging	1.00
R4970:Dhx32	UTSW	7	133738655	intron	probably benign
R5538:Dhx32	UTSW	7	133723217	missense	probably benign
R5616:Dhx32	UTSW	7	133721228	makesense	probably null
R5951:Dhx32	UTSW	7	133737328	missense	probably damaging	0.98
R6081:Dhx32	UTSW	7	133722212	missense	probably damaging	1.00
R6297:Dhx32	UTSW	7	133742800	missense	probably damaging	1.00
R6319:Dhx32	UTSW	7	133737226	missense	probably damaging	1.00
R7088:Dhx32	UTSW	7	133742688	missense	probably damaging	1.00
R7257:Dhx32	UTSW	7	133759477	missense	probably benign	0.08
R7686:Dhx32	UTSW	7	133759701	start codon destroyed	probably null
R7952:Dhx32	UTSW	7	133748996	missense	probably benign	0.30
R8025:Dhx32	UTSW	7	133721371	missense	probably damaging	1.00
R8255:Dhx32	UTSW	7	133737391	missense	probably benign	0.01
R8389:Dhx32	UTSW	7	133725206	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CCAACGCTCTGAGGATTGCAGAAC -3'
(R):5'- ACCATCTGCTGGGTTGGTGAAAG -3'

Sequencing Primer
(F):5'- CAACCTCAGGATTGTTTCAGTG -3'
(R):5'- TGCTGGGTTGGTGAAAGAAAAAG -3'

Posted On

2014-04-13