Incidental Mutation 'R1532:Dhx32'
ID166653
Institutional Source Beutler Lab
Gene Symbol Dhx32
Ensembl Gene ENSMUSG00000030986
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 32
SynonymsDdx32
MMRRC Submission 039571-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R1532 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location133720942-133782726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 133749024 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 106 (C106S)
Ref Sequence ENSEMBL: ENSMUSP00000066067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033290] [ENSMUST00000063669] [ENSMUST00000106139] [ENSMUST00000130182] [ENSMUST00000149876]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033290
AA Change: C106S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033290
Gene: ENSMUSG00000030986
AA Change: C106S

DomainStartEndE-ValueType
Blast:DEXDc 67 253 1e-107 BLAST
SCOP:d1jpna2 77 289 9e-21 SMART
HA2 465 556 3.35e-21 SMART
Pfam:OB_NTP_bind 597 704 1.7e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000063669
AA Change: C106S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066067
Gene: ENSMUSG00000030986
AA Change: C106S

DomainStartEndE-ValueType
Blast:DEXDc 67 253 1e-107 BLAST
SCOP:d1jpna2 77 289 9e-21 SMART
HA2 465 556 3.35e-21 SMART
Pfam:OB_NTP_bind 594 704 4.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106139
SMART Domains Protein: ENSMUSP00000101745
Gene: ENSMUSG00000030986

DomainStartEndE-ValueType
Blast:DEXDc 1 113 5e-54 BLAST
SCOP:d1jpna2 1 149 6e-11 SMART
HA2 325 416 3.35e-21 SMART
Pfam:OB_NTP_bind 457 564 1.2e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130182
AA Change: C106S

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115677
Gene: ENSMUSG00000030986
AA Change: C106S

DomainStartEndE-ValueType
PDB:3KX2|A 42 106 8e-11 PDB
Blast:DEXDc 67 110 2e-22 BLAST
SCOP:d1jpna2 77 109 1e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146211
Predicted Effect probably benign
Transcript: ENSMUST00000149876
SMART Domains Protein: ENSMUSP00000121789
Gene: ENSMUSG00000030986

DomainStartEndE-ValueType
PDB:3KX2|A 42 142 7e-19 PDB
Blast:DEXDc 67 143 6e-42 BLAST
SCOP:d1a1va1 82 143 3e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211450
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates 2 transcript variants, but the full length nature of one of the variants has not been defined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 C A 4: 86,248,065 H394N probably benign Het
Ahrr A G 13: 74,213,707 S558P probably benign Het
Ankrd26 T C 6: 118,522,958 N1184S probably damaging Het
Anpep A T 7: 79,826,948 C14* probably null Het
Arhgap18 A G 10: 26,860,722 D187G possibly damaging Het
Arhgef5 A G 6: 43,273,403 T363A probably benign Het
Atxn1 A T 13: 45,566,910 L503Q possibly damaging Het
Babam1 A G 8: 71,399,633 D155G possibly damaging Het
Bbs9 A G 9: 22,887,649 T858A probably benign Het
Cacna1g C A 11: 94,443,331 G828V probably damaging Het
Ccar2 T C 14: 70,142,956 T392A probably benign Het
Cd163 T C 6: 124,312,730 V469A possibly damaging Het
Cdh23 G T 10: 60,314,331 N2576K probably damaging Het
Coro2b A G 9: 62,489,423 Y18H probably damaging Het
Crispld2 G T 8: 120,023,572 K238N probably benign Het
Ctnnd2 T C 15: 30,921,868 I880T probably damaging Het
Cubn C A 2: 13,287,661 C3237F probably damaging Het
Ddx31 A G 2: 28,881,159 M519V probably benign Het
Diaph1 A G 18: 37,896,093 probably null Het
Dnaaf1 T C 8: 119,577,423 F67L probably benign Het
Duox1 T G 2: 122,344,723 L1334R probably damaging Het
Dync1li2 A T 8: 104,426,035 I322N probably damaging Het
Eml6 T C 11: 29,792,256 probably null Het
Entpd6 A G 2: 150,758,750 Q126R probably benign Het
Entpd7 C G 19: 43,691,077 P23R possibly damaging Het
Epha3 T C 16: 63,546,178 I970V probably benign Het
Fras1 A T 5: 96,713,996 H2163L probably damaging Het
Gse1 C G 8: 120,568,210 probably benign Het
Heatr5a A G 12: 51,952,518 V300A probably damaging Het
Hsd3b1 T A 3: 98,852,898 D259V probably damaging Het
Hspbap1 T C 16: 35,825,303 S453P probably damaging Het
Ifnl3 A G 7: 28,524,227 T163A probably benign Het
Igbp1b T A 6: 138,658,444 M1L possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lpxn T C 19: 12,804,092 probably null Het
Mast1 G A 8: 84,928,609 Q249* probably null Het
Mink1 A G 11: 70,602,007 D153G probably null Het
Mllt10 G A 2: 18,092,835 probably null Het
Mpl C T 4: 118,448,568 G420E possibly damaging Het
Ms4a1 T A 19: 11,253,193 T215S probably benign Het
Ncapd3 C T 9: 27,083,360 Q1179* probably null Het
Nr3c2 A G 8: 76,909,104 H278R probably damaging Het
Olfr1417 T C 19: 11,828,619 I136V probably benign Het
Olfr1454 A G 19: 13,064,275 Y288C probably damaging Het
Olfr670 T C 7: 104,960,265 I156V probably benign Het
Os9 C T 10: 127,098,902 V353M probably damaging Het
Osbpl5 A T 7: 143,695,080 M589K probably benign Het
Phf20 G T 2: 156,303,049 G859V possibly damaging Het
Pkhd1 G A 1: 20,117,401 T3561I probably benign Het
Prss46 G A 9: 110,850,168 V146I probably benign Het
Ptprk G A 10: 28,585,630 V1139M probably damaging Het
Ranbp10 A G 8: 105,774,331 L396P probably benign Het
Rb1cc1 A G 1: 6,249,734 T1126A probably benign Het
Rbl2 G A 8: 91,106,417 A659T probably benign Het
Rdm1 T C 11: 101,633,817 L192P probably damaging Het
Reln A C 5: 22,034,744 W842G probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sele A G 1: 164,053,851 K509R probably benign Het
Slc15a1 A T 14: 121,475,984 I377N possibly damaging Het
Slc17a3 G A 13: 23,856,500 G269D probably damaging Het
Slc35a5 T C 16: 45,151,557 T115A probably benign Het
Slc5a12 T G 2: 110,610,138 N157K possibly damaging Het
Sphkap A G 1: 83,257,203 V1634A probably damaging Het
Spta1 T C 1: 174,247,353 S2382P probably damaging Het
Synj2 C A 17: 6,033,919 S1100R probably benign Het
Tcf23 A G 5: 30,973,557 T180A probably benign Het
Tnxb T C 17: 34,710,830 V2846A probably damaging Het
Tpr T A 1: 150,418,000 I915K probably damaging Het
Uba1y C T Y: 828,862 H557Y probably benign Het
Unc45b T A 11: 82,936,874 D730E probably benign Het
Unc5b A T 10: 60,769,232 L734Q probably damaging Het
Vmn1r167 G T 7: 23,504,779 H271N probably benign Het
Vmn2r76 A G 7: 86,230,246 V282A probably benign Het
Xirp2 A G 2: 67,513,939 K2175E probably benign Het
Other mutations in Dhx32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Dhx32 APN 7 133748977 missense possibly damaging 0.76
IGL03398:Dhx32 APN 7 133759525 missense probably damaging 1.00
R0729:Dhx32 UTSW 7 133737421 missense probably benign 0.01
R1054:Dhx32 UTSW 7 133725272 missense probably damaging 1.00
R1438:Dhx32 UTSW 7 133737340 missense possibly damaging 0.87
R1864:Dhx32 UTSW 7 133737296 missense probably benign 0.00
R1865:Dhx32 UTSW 7 133737296 missense probably benign 0.00
R2074:Dhx32 UTSW 7 133721292 missense probably benign 0.04
R2075:Dhx32 UTSW 7 133721292 missense probably benign 0.04
R2119:Dhx32 UTSW 7 133722247 nonsense probably null
R2377:Dhx32 UTSW 7 133724478 missense probably damaging 1.00
R3125:Dhx32 UTSW 7 133725356 missense probably damaging 1.00
R4519:Dhx32 UTSW 7 133734109 missense probably damaging 1.00
R4970:Dhx32 UTSW 7 133738655 intron probably benign
R5538:Dhx32 UTSW 7 133723217 missense probably benign
R5616:Dhx32 UTSW 7 133721228 makesense probably null
R5951:Dhx32 UTSW 7 133737328 missense probably damaging 0.98
R6081:Dhx32 UTSW 7 133722212 missense probably damaging 1.00
R6297:Dhx32 UTSW 7 133742800 missense probably damaging 1.00
R6319:Dhx32 UTSW 7 133737226 missense probably damaging 1.00
R7088:Dhx32 UTSW 7 133742688 missense probably damaging 1.00
R7257:Dhx32 UTSW 7 133759477 missense probably benign 0.08
R7686:Dhx32 UTSW 7 133759701 start codon destroyed probably null
R7952:Dhx32 UTSW 7 133748996 missense probably benign 0.30
R8025:Dhx32 UTSW 7 133721371 missense probably damaging 1.00
R8255:Dhx32 UTSW 7 133737391 missense probably benign 0.01
R8389:Dhx32 UTSW 7 133725206 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCAACGCTCTGAGGATTGCAGAAC -3'
(R):5'- ACCATCTGCTGGGTTGGTGAAAG -3'

Sequencing Primer
(F):5'- CAACCTCAGGATTGTTTCAGTG -3'
(R):5'- TGCTGGGTTGGTGAAAGAAAAAG -3'
Posted On2014-04-13