Incidental Mutation 'R1532:Gse1'
ID166666
Institutional Source Beutler Lab
Gene Symbol Gse1
Ensembl Gene ENSMUSG00000031822
Gene Namegenetic suppressor element 1, coiled-coil protein
Synonyms
MMRRC Submission 039571-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R1532 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location120228456-120581390 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to G at 120568210 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034279] [ENSMUST00000118136] [ENSMUST00000120493] [ENSMUST00000127664]
Predicted Effect unknown
Transcript: ENSMUST00000034279
AA Change: R357G
SMART Domains Protein: ENSMUSP00000034279
Gene: ENSMUSG00000031822
AA Change: R357G

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
Pfam:DUF3736 81 216 2.9e-21 PFAM
coiled coil region 329 414 N/A INTRINSIC
Pfam:DUF3736 742 883 9.7e-46 PFAM
low complexity region 959 973 N/A INTRINSIC
low complexity region 1103 1124 N/A INTRINSIC
coiled coil region 1133 1207 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000118136
AA Change: R347G
SMART Domains Protein: ENSMUSP00000112981
Gene: ENSMUSG00000031822
AA Change: R347G

DomainStartEndE-ValueType
low complexity region 51 63 N/A INTRINSIC
Pfam:DUF3736 70 203 2.2e-39 PFAM
low complexity region 204 211 N/A INTRINSIC
coiled coil region 319 404 N/A INTRINSIC
Pfam:DUF3736 731 874 7.5e-48 PFAM
low complexity region 949 963 N/A INTRINSIC
low complexity region 1093 1114 N/A INTRINSIC
coiled coil region 1123 1197 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000120493
AA Change: R344G
SMART Domains Protein: ENSMUSP00000113577
Gene: ENSMUSG00000031822
AA Change: R344G

DomainStartEndE-ValueType
low complexity region 48 60 N/A INTRINSIC
Pfam:DUF3736 67 200 2.2e-39 PFAM
low complexity region 201 208 N/A INTRINSIC
coiled coil region 316 401 N/A INTRINSIC
Pfam:DUF3736 728 871 7.5e-48 PFAM
low complexity region 946 960 N/A INTRINSIC
low complexity region 1090 1111 N/A INTRINSIC
coiled coil region 1120 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211997
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 C A 4: 86,248,065 H394N probably benign Het
Ahrr A G 13: 74,213,707 S558P probably benign Het
Ankrd26 T C 6: 118,522,958 N1184S probably damaging Het
Anpep A T 7: 79,826,948 C14* probably null Het
Arhgap18 A G 10: 26,860,722 D187G possibly damaging Het
Arhgef5 A G 6: 43,273,403 T363A probably benign Het
Atxn1 A T 13: 45,566,910 L503Q possibly damaging Het
Babam1 A G 8: 71,399,633 D155G possibly damaging Het
Bbs9 A G 9: 22,887,649 T858A probably benign Het
Cacna1g C A 11: 94,443,331 G828V probably damaging Het
Ccar2 T C 14: 70,142,956 T392A probably benign Het
Cd163 T C 6: 124,312,730 V469A possibly damaging Het
Cdh23 G T 10: 60,314,331 N2576K probably damaging Het
Coro2b A G 9: 62,489,423 Y18H probably damaging Het
Crispld2 G T 8: 120,023,572 K238N probably benign Het
Ctnnd2 T C 15: 30,921,868 I880T probably damaging Het
Cubn C A 2: 13,287,661 C3237F probably damaging Het
Ddx31 A G 2: 28,881,159 M519V probably benign Het
Dhx32 A T 7: 133,749,024 C106S possibly damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Dnaaf1 T C 8: 119,577,423 F67L probably benign Het
Duox1 T G 2: 122,344,723 L1334R probably damaging Het
Dync1li2 A T 8: 104,426,035 I322N probably damaging Het
Eml6 T C 11: 29,792,256 probably null Het
Entpd6 A G 2: 150,758,750 Q126R probably benign Het
Entpd7 C G 19: 43,691,077 P23R possibly damaging Het
Epha3 T C 16: 63,546,178 I970V probably benign Het
Fras1 A T 5: 96,713,996 H2163L probably damaging Het
Heatr5a A G 12: 51,952,518 V300A probably damaging Het
Hsd3b1 T A 3: 98,852,898 D259V probably damaging Het
Hspbap1 T C 16: 35,825,303 S453P probably damaging Het
Ifnl3 A G 7: 28,524,227 T163A probably benign Het
Igbp1b T A 6: 138,658,444 M1L possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lpxn T C 19: 12,804,092 probably null Het
Mast1 G A 8: 84,928,609 Q249* probably null Het
Mink1 A G 11: 70,602,007 D153G probably null Het
Mllt10 G A 2: 18,092,835 probably null Het
Mpl C T 4: 118,448,568 G420E possibly damaging Het
Ms4a1 T A 19: 11,253,193 T215S probably benign Het
Ncapd3 C T 9: 27,083,360 Q1179* probably null Het
Nr3c2 A G 8: 76,909,104 H278R probably damaging Het
Olfr1417 T C 19: 11,828,619 I136V probably benign Het
Olfr1454 A G 19: 13,064,275 Y288C probably damaging Het
Olfr670 T C 7: 104,960,265 I156V probably benign Het
Os9 C T 10: 127,098,902 V353M probably damaging Het
Osbpl5 A T 7: 143,695,080 M589K probably benign Het
Phf20 G T 2: 156,303,049 G859V possibly damaging Het
Pkhd1 G A 1: 20,117,401 T3561I probably benign Het
Prss46 G A 9: 110,850,168 V146I probably benign Het
Ptprk G A 10: 28,585,630 V1139M probably damaging Het
Ranbp10 A G 8: 105,774,331 L396P probably benign Het
Rb1cc1 A G 1: 6,249,734 T1126A probably benign Het
Rbl2 G A 8: 91,106,417 A659T probably benign Het
Rdm1 T C 11: 101,633,817 L192P probably damaging Het
Reln A C 5: 22,034,744 W842G probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sele A G 1: 164,053,851 K509R probably benign Het
Slc15a1 A T 14: 121,475,984 I377N possibly damaging Het
Slc17a3 G A 13: 23,856,500 G269D probably damaging Het
Slc35a5 T C 16: 45,151,557 T115A probably benign Het
Slc5a12 T G 2: 110,610,138 N157K possibly damaging Het
Sphkap A G 1: 83,257,203 V1634A probably damaging Het
Spta1 T C 1: 174,247,353 S2382P probably damaging Het
Synj2 C A 17: 6,033,919 S1100R probably benign Het
Tcf23 A G 5: 30,973,557 T180A probably benign Het
Tnxb T C 17: 34,710,830 V2846A probably damaging Het
Tpr T A 1: 150,418,000 I915K probably damaging Het
Uba1y C T Y: 828,862 H557Y probably benign Het
Unc45b T A 11: 82,936,874 D730E probably benign Het
Unc5b A T 10: 60,769,232 L734Q probably damaging Het
Vmn1r167 G T 7: 23,504,779 H271N probably benign Het
Vmn2r76 A G 7: 86,230,246 V282A probably benign Het
Xirp2 A G 2: 67,513,939 K2175E probably benign Het
Other mutations in Gse1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Gse1 APN 8 120553587 start codon destroyed probably null 0.79
IGL02484:Gse1 APN 8 120575262 intron probably benign
IGL02931:Gse1 APN 8 120578069 intron probably benign
IGL03193:Gse1 APN 8 120571340 critical splice donor site probably null
R0027:Gse1 UTSW 8 120566546 intron probably benign
R0109:Gse1 UTSW 8 120567785 missense probably damaging 1.00
R0257:Gse1 UTSW 8 120572334 intron probably benign
R0967:Gse1 UTSW 8 120570855 intron probably benign
R1395:Gse1 UTSW 8 120574999 intron probably benign
R1480:Gse1 UTSW 8 120572394 intron probably benign
R1649:Gse1 UTSW 8 120578515 intron probably benign
R1728:Gse1 UTSW 8 120568253 intron probably benign
R1742:Gse1 UTSW 8 120566950 missense probably damaging 1.00
R1784:Gse1 UTSW 8 120568253 intron probably benign
R2081:Gse1 UTSW 8 120566480 missense probably damaging 1.00
R2110:Gse1 UTSW 8 120566980 missense probably damaging 1.00
R2974:Gse1 UTSW 8 120570897 intron probably benign
R3615:Gse1 UTSW 8 120572742 intron probably benign
R3616:Gse1 UTSW 8 120572742 intron probably benign
R3857:Gse1 UTSW 8 120571133 intron probably benign
R4201:Gse1 UTSW 8 120567764 missense probably benign 0.39
R4494:Gse1 UTSW 8 120570814 intron probably benign
R4857:Gse1 UTSW 8 120572757 intron probably benign
R4911:Gse1 UTSW 8 120568466 intron probably benign
R5640:Gse1 UTSW 8 120562677 missense possibly damaging 0.65
R5782:Gse1 UTSW 8 120566521 missense probably damaging 1.00
R5980:Gse1 UTSW 8 120229637 intron probably benign
R6090:Gse1 UTSW 8 120571169 intron probably benign
R6156:Gse1 UTSW 8 120489127 missense possibly damaging 0.95
R6191:Gse1 UTSW 8 120553803 critical splice donor site probably null
R6270:Gse1 UTSW 8 120569163 intron probably benign
R6502:Gse1 UTSW 8 120553689 unclassified probably null
R6573:Gse1 UTSW 8 120567797 missense probably damaging 1.00
R6885:Gse1 UTSW 8 120229482 intron probably benign
R6901:Gse1 UTSW 8 120229822 intron probably benign
R6959:Gse1 UTSW 8 120570971 intron probably benign
R7023:Gse1 UTSW 8 120230648 intron probably benign
R7210:Gse1 UTSW 8 120230702 missense unknown
R7263:Gse1 UTSW 8 120574171 missense unknown
R7449:Gse1 UTSW 8 120229711 missense unknown
R7602:Gse1 UTSW 8 120569304 missense unknown
R7627:Gse1 UTSW 8 120572777 missense unknown
R7635:Gse1 UTSW 8 120572895 missense unknown
R7689:Gse1 UTSW 8 120568478 missense unknown
X0026:Gse1 UTSW 8 120568163 nonsense probably null
Z1177:Gse1 UTSW 8 120229852 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGTAAGCTGTGTTTTCAGCAGAGG -3'
(R):5'- TTCTACCGCAGTGATGGCAACTCC -3'

Sequencing Primer
(F):5'- TCAGCAGAGGTGGGGTG -3'
(R):5'- GTTGGGATGGCACCTCCTTAC -3'
Posted On2014-04-13