Mutagenetix > Incidental Mutations

Incidental Mutation 'R1532:Slc15a1'

166688

Institutional Source

Beutler Lab

Gene Symbol

Slc15a1

Ensembl Gene

ENSMUSG00000025557

Gene Name

solute carrier family 15 (oligopeptide transporter), member 1

Synonyms

PECT1, PEPT1

MMRRC Submission

039571-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R1532 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121459621-121505252 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 121475984 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 377 (I377N)

Ref Sequence

ENSEMBL: ENSMUSP00000085728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088386]

AlphaFold

Q9JIP7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000088386
AA Change: I377N

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000085728
Gene: ENSMUSG00000025557
AA Change: I377N

Domain	Start	End	E-Value	Type
Pfam:PTR2	81	477	1.9e-141	PFAM
Pfam:PTR2	562	644	4.2e-11	PFAM
transmembrane domain	650	672	N/A	INTRINSIC
low complexity region	684	695	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227372

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intestinal hydrogen peptide cotransporter that is a member of the solute carrier family 15. The encoded protein is localized to the brush border membrane of the intestinal epithelium and mediates the uptake of di- and tripeptides from the lumen into the enterocytes. This protein plays an important role in the uptake and digestion of dietary proteins. This protein also facilitates the absorption of numerous peptidomimetic drugs. [provided by RefSeq, Apr 2010]
PHENOTYPE: Peptide uptake in the intestine is substantially reduced in mice homozygous for a null mutation of this gene. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl1	C	A	4: 86,248,065	H394N	probably benign	Het
Ahrr	A	G	13: 74,213,707	S558P	probably benign	Het
Ankrd26	T	C	6: 118,522,958	N1184S	probably damaging	Het
Anpep	A	T	7: 79,826,948	C14*	probably null	Het
Arhgap18	A	G	10: 26,860,722	D187G	possibly damaging	Het
Arhgef5	A	G	6: 43,273,403	T363A	probably benign	Het
Atxn1	A	T	13: 45,566,910	L503Q	possibly damaging	Het
Babam1	A	G	8: 71,399,633	D155G	possibly damaging	Het
Bbs9	A	G	9: 22,887,649	T858A	probably benign	Het
Cacna1g	C	A	11: 94,443,331	G828V	probably damaging	Het
Ccar2	T	C	14: 70,142,956	T392A	probably benign	Het
Cd163	T	C	6: 124,312,730	V469A	possibly damaging	Het
Cdh23	G	T	10: 60,314,331	N2576K	probably damaging	Het
Coro2b	A	G	9: 62,489,423	Y18H	probably damaging	Het
Crispld2	G	T	8: 120,023,572	K238N	probably benign	Het
Ctnnd2	T	C	15: 30,921,868	I880T	probably damaging	Het
Cubn	C	A	2: 13,287,661	C3237F	probably damaging	Het
Ddx31	A	G	2: 28,881,159	M519V	probably benign	Het
Dhx32	A	T	7: 133,749,024	C106S	possibly damaging	Het
Diaph1	A	G	18: 37,896,093		probably null	Het
Dnaaf1	T	C	8: 119,577,423	F67L	probably benign	Het
Duox1	T	G	2: 122,344,723	L1334R	probably damaging	Het
Dync1li2	A	T	8: 104,426,035	I322N	probably damaging	Het
Eml6	T	C	11: 29,792,256		probably null	Het
Entpd6	A	G	2: 150,758,750	Q126R	probably benign	Het
Entpd7	C	G	19: 43,691,077	P23R	possibly damaging	Het
Epha3	T	C	16: 63,546,178	I970V	probably benign	Het
Fras1	A	T	5: 96,713,996	H2163L	probably damaging	Het
Gse1	C	G	8: 120,568,210		probably benign	Het
Heatr5a	A	G	12: 51,952,518	V300A	probably damaging	Het
Hsd3b1	T	A	3: 98,852,898	D259V	probably damaging	Het
Hspbap1	T	C	16: 35,825,303	S453P	probably damaging	Het
Ifnl3	A	G	7: 28,524,227	T163A	probably benign	Het
Igbp1b	T	A	6: 138,658,444	M1L	possibly damaging	Het
Klra3	G	C	6: 130,333,144	R138G	probably benign	Het
Lpxn	T	C	19: 12,804,092		probably null	Het
Mast1	G	A	8: 84,928,609	Q249*	probably null	Het
Mink1	A	G	11: 70,602,007	D153G	probably null	Het
Mllt10	G	A	2: 18,092,835		probably null	Het
Mpl	C	T	4: 118,448,568	G420E	possibly damaging	Het
Ms4a1	T	A	19: 11,253,193	T215S	probably benign	Het
Ncapd3	C	T	9: 27,083,360	Q1179*	probably null	Het
Nr3c2	A	G	8: 76,909,104	H278R	probably damaging	Het
Olfr1417	T	C	19: 11,828,619	I136V	probably benign	Het
Olfr1454	A	G	19: 13,064,275	Y288C	probably damaging	Het
Olfr670	T	C	7: 104,960,265	I156V	probably benign	Het
Os9	C	T	10: 127,098,902	V353M	probably damaging	Het
Osbpl5	A	T	7: 143,695,080	M589K	probably benign	Het
Phf20	G	T	2: 156,303,049	G859V	possibly damaging	Het
Pkhd1	G	A	1: 20,117,401	T3561I	probably benign	Het
Prss46	G	A	9: 110,850,168	V146I	probably benign	Het
Ptprk	G	A	10: 28,585,630	V1139M	probably damaging	Het
Ranbp10	A	G	8: 105,774,331	L396P	probably benign	Het
Rb1cc1	A	G	1: 6,249,734	T1126A	probably benign	Het
Rbl2	G	A	8: 91,106,417	A659T	probably benign	Het
Rdm1	T	C	11: 101,633,817	L192P	probably damaging	Het
Reln	A	C	5: 22,034,744	W842G	probably damaging	Het
Scn5a	C	T	9: 119,533,847	R569H	probably damaging	Het
Sele	A	G	1: 164,053,851	K509R	probably benign	Het
Slc17a3	G	A	13: 23,856,500	G269D	probably damaging	Het
Slc35a5	T	C	16: 45,151,557	T115A	probably benign	Het
Slc5a12	T	G	2: 110,610,138	N157K	possibly damaging	Het
Sphkap	A	G	1: 83,257,203	V1634A	probably damaging	Het
Spta1	T	C	1: 174,247,353	S2382P	probably damaging	Het
Synj2	C	A	17: 6,033,919	S1100R	probably benign	Het
Tcf23	A	G	5: 30,973,557	T180A	probably benign	Het
Tnxb	T	C	17: 34,710,830	V2846A	probably damaging	Het
Tpr	T	A	1: 150,418,000	I915K	probably damaging	Het
Uba1y	C	T	Y: 828,862	H557Y	probably benign	Het
Unc45b	T	A	11: 82,936,874	D730E	probably benign	Het
Unc5b	A	T	10: 60,769,232	L734Q	probably damaging	Het
Vmn1r167	G	T	7: 23,504,779	H271N	probably benign	Het
Vmn2r76	A	G	7: 86,230,246	V282A	probably benign	Het
Xirp2	A	G	2: 67,513,939	K2175E	probably benign	Het

Other mutations in Slc15a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01337:Slc15a1	APN	14	121460679	missense	possibly damaging	0.95
IGL01534:Slc15a1	APN	14	121464952	missense	possibly damaging	0.95
IGL01783:Slc15a1	APN	14	121471276	critical splice donor site	probably null
IGL01799:Slc15a1	APN	14	121480729	missense	possibly damaging	0.76
IGL02064:Slc15a1	APN	14	121462499	missense	possibly damaging	0.66
IGL02064:Slc15a1	APN	14	121462474	missense	probably benign	0.20
IGL02115:Slc15a1	APN	14	121480661	missense	possibly damaging	0.61
IGL02514:Slc15a1	APN	14	121487040	missense	probably damaging	1.00
IGL03056:Slc15a1	APN	14	121491283	missense	possibly damaging	0.82
IGL03297:Slc15a1	APN	14	121486684	missense	probably damaging	1.00
R1484:Slc15a1	UTSW	14	121491239	nonsense	probably null
R1655:Slc15a1	UTSW	14	121465899	missense	probably benign	0.34
R2013:Slc15a1	UTSW	14	121475987	missense	possibly damaging	0.88
R2270:Slc15a1	UTSW	14	121479994	missense	probably damaging	0.99
R2878:Slc15a1	UTSW	14	121465933	missense	probably benign	0.00
R2986:Slc15a1	UTSW	14	121489809	missense	probably benign	0.02
R3862:Slc15a1	UTSW	14	121484857	missense	probably benign	0.06
R3863:Slc15a1	UTSW	14	121484857	missense	probably benign	0.06
R3978:Slc15a1	UTSW	14	121489827	missense	probably benign	0.00
R4184:Slc15a1	UTSW	14	121466162	missense	probably benign	0.00
R4573:Slc15a1	UTSW	14	121487029	missense	probably damaging	0.99
R4604:Slc15a1	UTSW	14	121489907	missense	probably damaging	1.00
R4649:Slc15a1	UTSW	14	121478092	missense	probably damaging	1.00
R5838:Slc15a1	UTSW	14	121484871	missense	probably damaging	1.00
R6221:Slc15a1	UTSW	14	121464904	missense	probably null	1.00
R6891:Slc15a1	UTSW	14	121476030	missense	probably benign	0.00
R7626:Slc15a1	UTSW	14	121475965	missense	probably benign	0.13
R7836:Slc15a1	UTSW	14	121480733	nonsense	probably null
R8284:Slc15a1	UTSW	14	121489863	missense	probably benign	0.01
R8376:Slc15a1	UTSW	14	121480703	missense	probably benign
R8408:Slc15a1	UTSW	14	121478116	missense	possibly damaging	0.91
R8774:Slc15a1	UTSW	14	121487011	missense	probably damaging	1.00
R8774-TAIL:Slc15a1	UTSW	14	121487011	missense	probably damaging	1.00
R8933:Slc15a1	UTSW	14	121486679	missense	probably benign	0.00
R9157:Slc15a1	UTSW	14	121464977	missense	probably benign	0.08
Z1088:Slc15a1	UTSW	14	121480054	missense	probably benign	0.09
Z1088:Slc15a1	UTSW	14	121491044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTAACTGATGGACTACTTTGCCCC -3'
(R):5'- TGCATACACTGAGAGCGCCCTC -3'

Sequencing Primer
(F):5'- GACTACTTTGCCCCACCCC -3'
(R):5'- gcatacactgagagcaccc -3'

Posted On

2014-04-13