Incidental Mutation 'R1532:Entpd7'
ID166703
Institutional Source Beutler Lab
Gene Symbol Entpd7
Ensembl Gene ENSMUSG00000025192
Gene Nameectonucleoside triphosphate diphosphohydrolase 7
Synonyms1810020C02Rik, 2810003F23Rik, 1810012B13Rik, LALP1, Lysal2
MMRRC Submission 039571-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R1532 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location43689672-43733697 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 43691077 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 23 (P23R)
Ref Sequence ENSEMBL: ENSMUSP00000079864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081079]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081079
AA Change: P23R

PolyPhen 2 Score 0.756 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000079864
Gene: ENSMUSG00000025192
AA Change: P23R

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
Pfam:GDA1_CD39 75 534 3.6e-106 PFAM
transmembrane domain 550 572 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152786
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for deletions in this gene have increased Th17 T cell levels in the lamina propria of the small intestine. They show increased resistance to Citrobacter rodentium infection and increased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 C A 4: 86,248,065 H394N probably benign Het
Ahrr A G 13: 74,213,707 S558P probably benign Het
Ankrd26 T C 6: 118,522,958 N1184S probably damaging Het
Anpep A T 7: 79,826,948 C14* probably null Het
Arhgap18 A G 10: 26,860,722 D187G possibly damaging Het
Arhgef5 A G 6: 43,273,403 T363A probably benign Het
Atxn1 A T 13: 45,566,910 L503Q possibly damaging Het
Babam1 A G 8: 71,399,633 D155G possibly damaging Het
Bbs9 A G 9: 22,887,649 T858A probably benign Het
Cacna1g C A 11: 94,443,331 G828V probably damaging Het
Ccar2 T C 14: 70,142,956 T392A probably benign Het
Cd163 T C 6: 124,312,730 V469A possibly damaging Het
Cdh23 G T 10: 60,314,331 N2576K probably damaging Het
Coro2b A G 9: 62,489,423 Y18H probably damaging Het
Crispld2 G T 8: 120,023,572 K238N probably benign Het
Ctnnd2 T C 15: 30,921,868 I880T probably damaging Het
Cubn C A 2: 13,287,661 C3237F probably damaging Het
Ddx31 A G 2: 28,881,159 M519V probably benign Het
Dhx32 A T 7: 133,749,024 C106S possibly damaging Het
Diaph1 A G 18: 37,896,093 probably null Het
Dnaaf1 T C 8: 119,577,423 F67L probably benign Het
Duox1 T G 2: 122,344,723 L1334R probably damaging Het
Dync1li2 A T 8: 104,426,035 I322N probably damaging Het
Eml6 T C 11: 29,792,256 probably null Het
Entpd6 A G 2: 150,758,750 Q126R probably benign Het
Epha3 T C 16: 63,546,178 I970V probably benign Het
Fras1 A T 5: 96,713,996 H2163L probably damaging Het
Gse1 C G 8: 120,568,210 probably benign Het
Heatr5a A G 12: 51,952,518 V300A probably damaging Het
Hsd3b1 T A 3: 98,852,898 D259V probably damaging Het
Hspbap1 T C 16: 35,825,303 S453P probably damaging Het
Ifnl3 A G 7: 28,524,227 T163A probably benign Het
Igbp1b T A 6: 138,658,444 M1L possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lpxn T C 19: 12,804,092 probably null Het
Mast1 G A 8: 84,928,609 Q249* probably null Het
Mink1 A G 11: 70,602,007 D153G probably null Het
Mllt10 G A 2: 18,092,835 probably null Het
Mpl C T 4: 118,448,568 G420E possibly damaging Het
Ms4a1 T A 19: 11,253,193 T215S probably benign Het
Ncapd3 C T 9: 27,083,360 Q1179* probably null Het
Nr3c2 A G 8: 76,909,104 H278R probably damaging Het
Olfr1417 T C 19: 11,828,619 I136V probably benign Het
Olfr1454 A G 19: 13,064,275 Y288C probably damaging Het
Olfr670 T C 7: 104,960,265 I156V probably benign Het
Os9 C T 10: 127,098,902 V353M probably damaging Het
Osbpl5 A T 7: 143,695,080 M589K probably benign Het
Phf20 G T 2: 156,303,049 G859V possibly damaging Het
Pkhd1 G A 1: 20,117,401 T3561I probably benign Het
Prss46 G A 9: 110,850,168 V146I probably benign Het
Ptprk G A 10: 28,585,630 V1139M probably damaging Het
Ranbp10 A G 8: 105,774,331 L396P probably benign Het
Rb1cc1 A G 1: 6,249,734 T1126A probably benign Het
Rbl2 G A 8: 91,106,417 A659T probably benign Het
Rdm1 T C 11: 101,633,817 L192P probably damaging Het
Reln A C 5: 22,034,744 W842G probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sele A G 1: 164,053,851 K509R probably benign Het
Slc15a1 A T 14: 121,475,984 I377N possibly damaging Het
Slc17a3 G A 13: 23,856,500 G269D probably damaging Het
Slc35a5 T C 16: 45,151,557 T115A probably benign Het
Slc5a12 T G 2: 110,610,138 N157K possibly damaging Het
Sphkap A G 1: 83,257,203 V1634A probably damaging Het
Spta1 T C 1: 174,247,353 S2382P probably damaging Het
Synj2 C A 17: 6,033,919 S1100R probably benign Het
Tcf23 A G 5: 30,973,557 T180A probably benign Het
Tnxb T C 17: 34,710,830 V2846A probably damaging Het
Tpr T A 1: 150,418,000 I915K probably damaging Het
Uba1y C T Y: 828,862 H557Y probably benign Het
Unc45b T A 11: 82,936,874 D730E probably benign Het
Unc5b A T 10: 60,769,232 L734Q probably damaging Het
Vmn1r167 G T 7: 23,504,779 H271N probably benign Het
Vmn2r76 A G 7: 86,230,246 V282A probably benign Het
Xirp2 A G 2: 67,513,939 K2175E probably benign Het
Other mutations in Entpd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Entpd7 APN 19 43729839 missense probably benign 0.00
R0056:Entpd7 UTSW 19 43725294 missense probably benign 0.09
R0118:Entpd7 UTSW 19 43704312 nonsense probably null
R0639:Entpd7 UTSW 19 43691094 missense probably benign 0.42
R1479:Entpd7 UTSW 19 43721840 missense probably damaging 1.00
R1647:Entpd7 UTSW 19 43721745 splice site probably benign
R1689:Entpd7 UTSW 19 43725476 missense probably damaging 0.96
R2230:Entpd7 UTSW 19 43721816 missense probably benign 0.07
R2231:Entpd7 UTSW 19 43721816 missense probably benign 0.07
R2422:Entpd7 UTSW 19 43728088 missense possibly damaging 0.66
R3807:Entpd7 UTSW 19 43725540 critical splice donor site probably null
R3914:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R3949:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R4021:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R4022:Entpd7 UTSW 19 43691158 missense probably benign 0.00
R4095:Entpd7 UTSW 19 43704201 missense probably damaging 1.00
R4737:Entpd7 UTSW 19 43691195 nonsense probably null
R5582:Entpd7 UTSW 19 43704994 missense probably damaging 1.00
R5653:Entpd7 UTSW 19 43691157 nonsense probably null
R5763:Entpd7 UTSW 19 43704266 missense probably damaging 1.00
R6508:Entpd7 UTSW 19 43691086 missense probably damaging 1.00
R7657:Entpd7 UTSW 19 43725467 missense possibly damaging 0.67
R8013:Entpd7 UTSW 19 43728055 missense probably benign 0.00
R8235:Entpd7 UTSW 19 43717545 missense probably damaging 1.00
Z1176:Entpd7 UTSW 19 43725358 missense probably benign 0.43
Z1177:Entpd7 UTSW 19 43725497 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGCTTGCCTTTCATTTGCAAC -3'
(R):5'- GGTCAGTCCCCTGAACTACAAACG -3'

Sequencing Primer
(F):5'- AAACCATTTAGACTTCTCTTGACCTG -3'
(R):5'- CCTGAACTACAAACGTAAGGTTG -3'
Posted On2014-04-13