Incidental Mutation 'R1533:Cfh'
ID166709
Institutional Source Beutler Lab
Gene Symbol Cfh
Ensembl Gene ENSMUSG00000026365
Gene Namecomplement component factor h
SynonymsMud-1, Sas1, Sas-1
MMRRC Submission 039572-MU
Accession Numbers

Genbank: NM_009888; MGI: 88385

Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R1533 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location140084708-140183764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140100978 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 466 (D466V)
Ref Sequence ENSEMBL: ENSMUSP00000141209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066859] [ENSMUST00000111976] [ENSMUST00000111977] [ENSMUST00000123238] [ENSMUST00000192880]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066859
AA Change: D993V

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066677
Gene: ENSMUSG00000026365
AA Change: D993V

DomainStartEndE-ValueType
CCP 21 80 7.75e-8 SMART
CCP 85 141 2.17e-11 SMART
CCP 146 205 7.5e-15 SMART
CCP 210 262 6.29e-8 SMART
CCP 267 320 2.04e-7 SMART
CCP 325 385 6.35e-4 SMART
CCP 389 442 1.15e-10 SMART
CCP 448 505 3.62e-8 SMART
CCP 509 564 6.45e-5 SMART
CCP 569 622 5.56e-9 SMART
CCP 629 683 3.45e-14 SMART
CCP 690 743 1.82e-13 SMART
CCP 752 802 6.59e-1 SMART
CCP 808 861 1.04e-8 SMART
CCP 867 931 4.66e-11 SMART
CCP 936 989 3.9e-13 SMART
CCP 994 1048 1.4e-14 SMART
CCP 1053 1107 2.09e-13 SMART
CCP 1114 1168 8.04e-15 SMART
CCP 1172 1233 5.57e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111976
AA Change: D1011V

PolyPhen 2 Score 0.523 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107607
Gene: ENSMUSG00000026365
AA Change: D1011V

DomainStartEndE-ValueType
CCP 39 98 7.75e-8 SMART
CCP 103 159 2.17e-11 SMART
CCP 164 223 7.5e-15 SMART
CCP 228 280 6.29e-8 SMART
CCP 285 338 2.04e-7 SMART
CCP 343 403 6.35e-4 SMART
CCP 407 460 1.15e-10 SMART
CCP 466 523 3.62e-8 SMART
CCP 527 582 6.45e-5 SMART
CCP 587 640 5.56e-9 SMART
CCP 647 701 3.45e-14 SMART
CCP 708 761 1.82e-13 SMART
CCP 770 820 6.59e-1 SMART
CCP 826 879 1.04e-8 SMART
CCP 885 949 4.66e-11 SMART
CCP 954 1007 3.9e-13 SMART
CCP 1012 1066 1.4e-14 SMART
CCP 1071 1125 2.09e-13 SMART
CCP 1132 1186 8.04e-15 SMART
CCP 1190 1251 5.57e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111977
AA Change: D954V

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107608
Gene: ENSMUSG00000026365
AA Change: D954V

DomainStartEndE-ValueType
CCP 21 80 7.75e-8 SMART
CCP 85 141 2.17e-11 SMART
CCP 146 205 7.5e-15 SMART
CCP 210 262 6.29e-8 SMART
CCP 267 320 2.04e-7 SMART
CCP 325 385 6.35e-4 SMART
CCP 389 442 1.15e-10 SMART
CCP 448 505 3.62e-8 SMART
CCP 509 564 6.45e-5 SMART
CCP 572 626 3.45e-14 SMART
CCP 633 686 1.82e-13 SMART
CCP 695 745 6.59e-1 SMART
CCP 751 804 1.04e-8 SMART
CCP 810 874 4.66e-11 SMART
CCP 879 932 3.9e-13 SMART
CCP 937 991 1.4e-14 SMART
CCP 996 1050 2.09e-13 SMART
CCP 1057 1111 8.04e-15 SMART
CCP 1115 1176 5.57e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000123238
AA Change: D993V

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115166
Gene: ENSMUSG00000026365
AA Change: D993V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CCP 21 80 7.75e-8 SMART
CCP 85 141 2.17e-11 SMART
CCP 146 205 7.5e-15 SMART
CCP 210 262 6.29e-8 SMART
CCP 267 320 2.04e-7 SMART
CCP 325 385 6.35e-4 SMART
CCP 389 442 1.15e-10 SMART
CCP 448 505 3.62e-8 SMART
CCP 509 564 6.45e-5 SMART
CCP 569 622 5.56e-9 SMART
CCP 629 683 3.45e-14 SMART
CCP 690 743 1.82e-13 SMART
CCP 752 802 6.59e-1 SMART
CCP 808 861 1.04e-8 SMART
CCP 867 931 4.66e-11 SMART
CCP 936 989 3.9e-13 SMART
CCP 994 1048 1.4e-14 SMART
CCP 1053 1107 2.09e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000192880
AA Change: D466V

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141209
Gene: ENSMUSG00000026365
AA Change: D466V

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CCP 39 98 3.9e-10 SMART
CCP 103 159 1e-13 SMART
CCP 164 223 3.7e-17 SMART
CCP 228 280 3.1e-10 SMART
CCP 285 338 9.9e-10 SMART
CCP 343 403 3.2e-6 SMART
CCP 407 460 5.6e-13 SMART
CCP 467 521 6.7e-17 SMART
CCP 526 580 1e-15 SMART
CCP 587 641 3.8e-17 SMART
CCP 645 706 2.7e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000192919
AA Change: D654V
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Regulator of Complement Activation (RCA) gene cluster and encodes a protein with twenty short consensus repeat (SCR) domains. This protein is secreted into the bloodstream and has an essential role in the regulation of complement activation, restricting this innate defense mechanism to microbial infections. Mutations in this gene have been associated with hemolytic-uremic syndrome (HUS) and chronic hypocomplementemic nephropathy. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutation of this gene results in markedly reduced serum C3, abnormal renal histology, spontaneous membranoproliferative glomerulonephritis (MPGN), hematuria, proteinuria, and increased mortality at 8 months of age. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 37,041,375 G4509V probably damaging Het
Abca4 G C 3: 122,135,158 G1340A probably benign Het
Ambra1 T A 2: 91,886,865 Y836N probably damaging Het
Arhgap26 A T 18: 39,371,077 H144L probably benign Het
B3gnt5 A G 16: 19,769,614 I194M probably damaging Het
Bod1l A T 5: 41,822,155 C605* probably null Het
C2cd3 G T 7: 100,406,077 K482N possibly damaging Het
Ccdc114 T A 7: 45,942,858 M354K probably benign Het
Cd300lg T A 11: 102,043,221 L98Q probably damaging Het
Cerkl T A 2: 79,341,357 I386F possibly damaging Het
Crtc1 A T 8: 70,398,299 I221N probably damaging Het
Ctnnbl1 T C 2: 157,836,643 S389P probably benign Het
Ctsb A T 14: 63,139,095 D258V probably damaging Het
Cuzd1 G T 7: 131,311,703 T395N probably damaging Het
Dnah6 T C 6: 73,151,553 T1240A probably benign Het
Dok7 T A 5: 35,064,327 probably null Het
Dscaml1 T C 9: 45,450,584 V214A probably damaging Het
Enpp6 A T 8: 47,065,434 Y199F probably benign Het
Entpd5 C A 12: 84,394,660 K111N probably damaging Het
Fam98a A G 17: 75,541,281 L146S probably damaging Het
Fhod3 A T 18: 25,115,864 I1367F probably damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fpr3 T A 17: 17,970,660 Y64* probably null Het
Fzd6 A T 15: 39,031,624 H395L probably damaging Het
Gcsh T A 8: 116,989,182 H54L probably damaging Het
Gsdma T A 11: 98,676,384 S437T unknown Het
Gzmc A G 14: 56,233,919 V55A probably damaging Het
Hecw2 T A 1: 53,926,545 probably null Het
Ifi207 A G 1: 173,727,740 V792A probably benign Het
Itpr3 C A 17: 27,095,560 N661K possibly damaging Het
Jmy A T 13: 93,441,311 I783N probably benign Het
Kcmf1 T C 6: 72,843,020 E281G possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lgr6 T A 1: 135,104,932 Y70F possibly damaging Het
Lnx1 T G 5: 74,620,017 D330A probably damaging Het
Lrp5 T C 19: 3,614,234 N106S probably benign Het
Mamdc4 C A 2: 25,569,747 R135L possibly damaging Het
Mcm3ap A G 10: 76,504,287 E1464G probably damaging Het
Megf8 T C 7: 25,334,855 V666A possibly damaging Het
Mettl3 T A 14: 52,296,928 E331D probably benign Het
Mphosph9 T C 5: 124,267,141 K789R probably damaging Het
Mtf2 T C 5: 108,092,129 L234P probably damaging Het
Ncdn C A 4: 126,748,698 E389* probably null Het
Ndor1 A G 2: 25,249,267 S231P probably damaging Het
Nelfa T G 5: 33,898,871 K483Q probably damaging Het
Olfr311 A G 11: 58,841,966 N284S probably damaging Het
Olfr538 T A 7: 140,575,121 probably null Het
Opn1sw C T 6: 29,378,924 R243Q probably benign Het
Pik3cd T C 4: 149,655,196 E584G probably damaging Het
Plcb3 A T 19: 6,957,673 M870K possibly damaging Het
Poc5 A G 13: 96,391,644 D16G probably damaging Het
Prpf40a A G 2: 53,145,840 I633T probably damaging Het
Ptpn13 G T 5: 103,556,178 E1359* probably null Het
Ptprr C A 10: 116,188,208 Y4* probably null Het
Rbm45 T C 2: 76,372,159 probably null Het
Rfng C T 11: 120,781,861 W320* probably null Het
Rgs6 G T 12: 83,091,773 V294L probably benign Het
Rufy4 T C 1: 74,129,843 probably null Het
Ruvbl2 T A 7: 45,424,142 N313I probably damaging Het
Sema4g G A 19: 44,992,817 V70M probably damaging Het
Siglec1 T C 2: 131,076,158 T969A probably benign Het
Slc22a27 T A 19: 7,866,983 T431S possibly damaging Het
Slc25a16 G A 10: 62,920,864 R38H probably damaging Het
Slc38a6 T C 12: 73,344,852 V296A probably benign Het
Slc39a11 C T 11: 113,305,922 V212I probably damaging Het
Sltm A G 9: 70,586,666 K782E probably damaging Het
Styxl1 T A 5: 135,770,321 Y23F probably damaging Het
Svs4 T C 2: 164,278,228 I20V unknown Het
Syt14 G T 1: 192,930,776 T572K possibly damaging Het
Tbc1d5 A T 17: 50,920,575 I214N possibly damaging Het
Tm9sf3 A G 19: 41,238,784 S283P probably benign Het
Tmtc1 C T 6: 148,245,710 probably null Het
Ttll7 T A 3: 146,896,667 N73K probably damaging Het
Ttn T A 2: 76,772,458 K18473N probably damaging Het
Ubr2 A C 17: 46,967,247 Y721* probably null Het
Vmn1r14 T A 6: 57,234,301 I288N probably damaging Het
Vmn2r103 T C 17: 19,773,400 I13T probably benign Het
Vps13a A T 19: 16,701,130 Y1162* probably null Het
Vps51 C A 19: 6,071,467 R175L probably benign Het
Zfp523 C A 17: 28,204,499 S149R probably benign Het
Zik1 A G 7: 10,490,126 I348T possibly damaging Het
Znfx1 T A 2: 167,056,788 H72L probably benign Het
Other mutations in Cfh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Cfh APN 1 140088682 missense probably damaging 1.00
IGL01124:Cfh APN 1 140183261 missense probably benign 0.01
IGL01389:Cfh APN 1 140154639 missense probably benign 0.44
IGL01455:Cfh APN 1 140105539 missense possibly damaging 0.51
IGL01877:Cfh APN 1 140100829 missense probably damaging 1.00
IGL02836:Cfh APN 1 140102399 missense probably damaging 1.00
IGL02937:Cfh APN 1 140105442 missense probably benign 0.19
IGL03039:Cfh APN 1 140136261 missense possibly damaging 0.86
IGL03069:Cfh APN 1 140099055 intron probably benign
IGL03192:Cfh APN 1 140099021 missense possibly damaging 0.71
IGL03201:Cfh APN 1 140102819 missense probably damaging 1.00
3-1:Cfh UTSW 1 140163125 missense probably damaging 1.00
PIT4449001:Cfh UTSW 1 140112565 missense probably damaging 1.00
R0257:Cfh UTSW 1 140144035 missense probably benign 0.01
R0294:Cfh UTSW 1 140183261 missense probably benign 0.01
R0571:Cfh UTSW 1 140102333 splice site probably null
R0576:Cfh UTSW 1 140136815 missense probably damaging 0.99
R0586:Cfh UTSW 1 140183182 missense probably damaging 0.98
R0605:Cfh UTSW 1 140102358 missense probably damaging 1.00
R0617:Cfh UTSW 1 140100883 missense probably benign 0.01
R0725:Cfh UTSW 1 140157343 splice site probably benign
R0853:Cfh UTSW 1 140105490 missense probably damaging 1.00
R1430:Cfh UTSW 1 140102698 splice site probably benign
R1500:Cfh UTSW 1 140100876 missense probably damaging 1.00
R1667:Cfh UTSW 1 140105523 missense probably benign 0.01
R1695:Cfh UTSW 1 140102837 missense probably damaging 0.98
R1728:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1729:Cfh UTSW 1 140136788 missense probably benign 0.02
R1729:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1730:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1739:Cfh UTSW 1 140136788 missense probably benign 0.02
R1739:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1756:Cfh UTSW 1 140100877 missense probably damaging 1.00
R1762:Cfh UTSW 1 140136788 missense probably benign 0.02
R1762:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1783:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1784:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1785:Cfh UTSW 1 140136788 missense probably benign 0.02
R1785:Cfh UTSW 1 140147697 missense possibly damaging 0.55
R1912:Cfh UTSW 1 140136141 splice site probably null
R2273:Cfh UTSW 1 140102825 missense probably damaging 1.00
R2288:Cfh UTSW 1 140098901 missense possibly damaging 0.70
R3725:Cfh UTSW 1 140086496 missense probably damaging 0.99
R3731:Cfh UTSW 1 140119970 missense possibly damaging 0.71
R4060:Cfh UTSW 1 140119926 missense possibly damaging 0.91
R4192:Cfh UTSW 1 140102716 missense possibly damaging 0.50
R4226:Cfh UTSW 1 140108926 missense probably damaging 1.00
R4425:Cfh UTSW 1 140100875 nonsense probably null
R4431:Cfh UTSW 1 140136266 missense probably damaging 1.00
R4712:Cfh UTSW 1 140108536 missense probably damaging 1.00
R4755:Cfh UTSW 1 140088808 missense probably damaging 1.00
R4792:Cfh UTSW 1 140100823 nonsense probably null
R4831:Cfh UTSW 1 140086387 missense probably benign
R5052:Cfh UTSW 1 140144044 missense probably damaging 0.96
R5181:Cfh UTSW 1 140147646 splice site probably benign
R5205:Cfh UTSW 1 140143970 missense probably damaging 1.00
R5285:Cfh UTSW 1 140100898 missense probably benign 0.21
R5366:Cfh UTSW 1 140136235 missense probably damaging 1.00
R5776:Cfh UTSW 1 140144023 missense possibly damaging 0.83
R5914:Cfh UTSW 1 140136229 missense probably benign 0.39
R5948:Cfh UTSW 1 140108808 missense probably damaging 0.96
R5979:Cfh UTSW 1 140118671 missense possibly damaging 0.66
R6034:Cfh UTSW 1 140163131 missense probably damaging 0.98
R6034:Cfh UTSW 1 140163131 missense probably damaging 0.98
R6059:Cfh UTSW 1 140118690 missense possibly damaging 0.92
R6198:Cfh UTSW 1 140105440 missense probably damaging 1.00
R6306:Cfh UTSW 1 140102417 missense probably damaging 1.00
R6523:Cfh UTSW 1 140101707 missense possibly damaging 0.82
R6610:Cfh UTSW 1 140101748 nonsense probably null
R6652:Cfh UTSW 1 140144068 missense probably benign 0.39
R6852:Cfh UTSW 1 140147749 missense probably damaging 1.00
R6861:Cfh UTSW 1 140100883 missense probably benign 0.07
R6862:Cfh UTSW 1 140102362 missense probably damaging 1.00
R7065:Cfh UTSW 1 140086402 missense probably damaging 0.99
R7191:Cfh UTSW 1 140112567 missense probably benign 0.04
R7197:Cfh UTSW 1 140088767 nonsense probably null
R7355:Cfh UTSW 1 140136815 missense probably damaging 1.00
R7367:Cfh UTSW 1 140086521 missense probably damaging 0.97
R7419:Cfh UTSW 1 140105466 missense probably damaging 0.99
R7579:Cfh UTSW 1 140108590 missense possibly damaging 0.53
R7586:Cfh UTSW 1 140147721 missense probably damaging 0.99
T0975:Cfh UTSW 1 140154598 missense probably benign 0.05
Z1088:Cfh UTSW 1 140108904 missense probably benign 0.04
Z1088:Cfh UTSW 1 140147718 missense possibly damaging 0.77
Z1177:Cfh UTSW 1 140144059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACTGGCTGTCCAATCCACCGAC -3'
(R):5'- AGTGGTCTGACCCACCAAAATGC -3'

Sequencing Primer
(F):5'- CGACTATTAACACATGTCACAGTGTC -3'
(R):5'- GAAGCTACCTATTGTTC -3'
Posted On2014-04-13