Incidental Mutation 'R1533:Ifi207'
ID166710
Institutional Source Beutler Lab
Gene Symbol Ifi207
Ensembl Gene ENSMUSG00000073490
Gene Nameinterferon activated gene 207
SynonymsPyhin-A, AI607873
MMRRC Submission 039572-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R1533 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location173723427-173741747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 173727740 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 792 (V792A)
Ref Sequence ENSEMBL: ENSMUSP00000119350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042610] [ENSMUST00000127730]
Predicted Effect probably benign
Transcript: ENSMUST00000042610
AA Change: V799A

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000048129
Gene: ENSMUSG00000073490
AA Change: V799A

DomainStartEndE-ValueType
PYRIN 6 84 3.2e-15 SMART
low complexity region 121 133 N/A INTRINSIC
low complexity region 136 162 N/A INTRINSIC
low complexity region 207 215 N/A INTRINSIC
internal_repeat_1 286 472 4.17e-7 PROSPERO
low complexity region 476 496 N/A INTRINSIC
internal_repeat_1 565 782 4.17e-7 PROSPERO
Pfam:HIN 788 954 4.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127730
AA Change: V792A

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119350
Gene: ENSMUSG00000073490
AA Change: V792A

DomainStartEndE-ValueType
PYRIN 6 84 3.2e-15 SMART
low complexity region 121 133 N/A INTRINSIC
low complexity region 136 155 N/A INTRINSIC
low complexity region 200 208 N/A INTRINSIC
internal_repeat_1 279 465 6.41e-7 PROSPERO
low complexity region 469 489 N/A INTRINSIC
internal_repeat_1 558 775 6.41e-7 PROSPERO
Pfam:HIN 781 948 1.8e-78 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 37,041,375 G4509V probably damaging Het
Abca4 G C 3: 122,135,158 G1340A probably benign Het
Ambra1 T A 2: 91,886,865 Y836N probably damaging Het
Arhgap26 A T 18: 39,371,077 H144L probably benign Het
B3gnt5 A G 16: 19,769,614 I194M probably damaging Het
Bod1l A T 5: 41,822,155 C605* probably null Het
C2cd3 G T 7: 100,406,077 K482N possibly damaging Het
Ccdc114 T A 7: 45,942,858 M354K probably benign Het
Cd300lg T A 11: 102,043,221 L98Q probably damaging Het
Cerkl T A 2: 79,341,357 I386F possibly damaging Het
Cfh T A 1: 140,100,978 D466V possibly damaging Het
Crtc1 A T 8: 70,398,299 I221N probably damaging Het
Ctnnbl1 T C 2: 157,836,643 S389P probably benign Het
Ctsb A T 14: 63,139,095 D258V probably damaging Het
Cuzd1 G T 7: 131,311,703 T395N probably damaging Het
Dnah6 T C 6: 73,151,553 T1240A probably benign Het
Dok7 T A 5: 35,064,327 probably null Het
Dscaml1 T C 9: 45,450,584 V214A probably damaging Het
Enpp6 A T 8: 47,065,434 Y199F probably benign Het
Entpd5 C A 12: 84,394,660 K111N probably damaging Het
Fam98a A G 17: 75,541,281 L146S probably damaging Het
Fhod3 A T 18: 25,115,864 I1367F probably damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fpr3 T A 17: 17,970,660 Y64* probably null Het
Fzd6 A T 15: 39,031,624 H395L probably damaging Het
Gcsh T A 8: 116,989,182 H54L probably damaging Het
Gsdma T A 11: 98,676,384 S437T unknown Het
Gzmc A G 14: 56,233,919 V55A probably damaging Het
Hecw2 T A 1: 53,926,545 probably null Het
Itpr3 C A 17: 27,095,560 N661K possibly damaging Het
Jmy A T 13: 93,441,311 I783N probably benign Het
Kcmf1 T C 6: 72,843,020 E281G possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lgr6 T A 1: 135,104,932 Y70F possibly damaging Het
Lnx1 T G 5: 74,620,017 D330A probably damaging Het
Lrp5 T C 19: 3,614,234 N106S probably benign Het
Mamdc4 C A 2: 25,569,747 R135L possibly damaging Het
Mcm3ap A G 10: 76,504,287 E1464G probably damaging Het
Megf8 T C 7: 25,334,855 V666A possibly damaging Het
Mettl3 T A 14: 52,296,928 E331D probably benign Het
Mphosph9 T C 5: 124,267,141 K789R probably damaging Het
Mtf2 T C 5: 108,092,129 L234P probably damaging Het
Ncdn C A 4: 126,748,698 E389* probably null Het
Ndor1 A G 2: 25,249,267 S231P probably damaging Het
Nelfa T G 5: 33,898,871 K483Q probably damaging Het
Olfr311 A G 11: 58,841,966 N284S probably damaging Het
Olfr538 T A 7: 140,575,121 probably null Het
Opn1sw C T 6: 29,378,924 R243Q probably benign Het
Pik3cd T C 4: 149,655,196 E584G probably damaging Het
Plcb3 A T 19: 6,957,673 M870K possibly damaging Het
Poc5 A G 13: 96,391,644 D16G probably damaging Het
Prpf40a A G 2: 53,145,840 I633T probably damaging Het
Ptpn13 G T 5: 103,556,178 E1359* probably null Het
Ptprr C A 10: 116,188,208 Y4* probably null Het
Rbm45 T C 2: 76,372,159 probably null Het
Rfng C T 11: 120,781,861 W320* probably null Het
Rgs6 G T 12: 83,091,773 V294L probably benign Het
Rufy4 T C 1: 74,129,843 probably null Het
Ruvbl2 T A 7: 45,424,142 N313I probably damaging Het
Sema4g G A 19: 44,992,817 V70M probably damaging Het
Siglec1 T C 2: 131,076,158 T969A probably benign Het
Slc22a27 T A 19: 7,866,983 T431S possibly damaging Het
Slc25a16 G A 10: 62,920,864 R38H probably damaging Het
Slc38a6 T C 12: 73,344,852 V296A probably benign Het
Slc39a11 C T 11: 113,305,922 V212I probably damaging Het
Sltm A G 9: 70,586,666 K782E probably damaging Het
Styxl1 T A 5: 135,770,321 Y23F probably damaging Het
Svs4 T C 2: 164,278,228 I20V unknown Het
Syt14 G T 1: 192,930,776 T572K possibly damaging Het
Tbc1d5 A T 17: 50,920,575 I214N possibly damaging Het
Tm9sf3 A G 19: 41,238,784 S283P probably benign Het
Tmtc1 C T 6: 148,245,710 probably null Het
Ttll7 T A 3: 146,896,667 N73K probably damaging Het
Ttn T A 2: 76,772,458 K18473N probably damaging Het
Ubr2 A C 17: 46,967,247 Y721* probably null Het
Vmn1r14 T A 6: 57,234,301 I288N probably damaging Het
Vmn2r103 T C 17: 19,773,400 I13T probably benign Het
Vps13a A T 19: 16,701,130 Y1162* probably null Het
Vps51 C A 19: 6,071,467 R175L probably benign Het
Zfp523 C A 17: 28,204,499 S149R probably benign Het
Zik1 A G 7: 10,490,126 I348T possibly damaging Het
Znfx1 T A 2: 167,056,788 H72L probably benign Het
Other mutations in Ifi207
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01776:Ifi207 APN 1 173725044 missense probably damaging 1.00
IGL01864:Ifi207 APN 1 173736441 missense possibly damaging 0.72
IGL02293:Ifi207 APN 1 173723748 missense probably damaging 1.00
IGL02402:Ifi207 APN 1 173727593 missense probably damaging 1.00
IGL03160:Ifi207 APN 1 173735104 splice site probably benign
PIT4458001:Ifi207 UTSW 1 173735172 missense unknown
R0043:Ifi207 UTSW 1 173729112 missense possibly damaging 0.48
R0212:Ifi207 UTSW 1 173736398 missense possibly damaging 0.85
R0395:Ifi207 UTSW 1 173729865 missense possibly damaging 0.85
R0506:Ifi207 UTSW 1 173736312 missense possibly damaging 0.52
R0843:Ifi207 UTSW 1 173727577 missense probably damaging 1.00
R1302:Ifi207 UTSW 1 173735295 missense possibly damaging 0.96
R1373:Ifi207 UTSW 1 173730347 missense unknown
R1462:Ifi207 UTSW 1 173724947 missense probably damaging 1.00
R1462:Ifi207 UTSW 1 173724947 missense probably damaging 1.00
R1471:Ifi207 UTSW 1 173730063 missense unknown
R1502:Ifi207 UTSW 1 173729306 missense possibly damaging 0.56
R1831:Ifi207 UTSW 1 173732426 missense unknown
R1928:Ifi207 UTSW 1 173729645 missense possibly damaging 0.68
R1982:Ifi207 UTSW 1 173735239 missense probably benign 0.01
R2132:Ifi207 UTSW 1 173729771 missense possibly damaging 0.84
R2248:Ifi207 UTSW 1 173736470 splice site probably benign
R3703:Ifi207 UTSW 1 173727463 nonsense probably null
R3741:Ifi207 UTSW 1 173727562 missense probably damaging 1.00
R3846:Ifi207 UTSW 1 173735303 missense probably benign 0.33
R4747:Ifi207 UTSW 1 173729067 missense probably benign 0.00
R4772:Ifi207 UTSW 1 173727687 missense probably damaging 1.00
R4776:Ifi207 UTSW 1 173730056 missense unknown
R4855:Ifi207 UTSW 1 173729815 missense probably damaging 0.96
R5170:Ifi207 UTSW 1 173730498 missense unknown
R5244:Ifi207 UTSW 1 173729937 missense probably benign 0.04
R5280:Ifi207 UTSW 1 173730304 missense unknown
R5301:Ifi207 UTSW 1 173729411 missense possibly damaging 0.83
R5334:Ifi207 UTSW 1 173727531 missense probably benign 0.21
R5445:Ifi207 UTSW 1 173727797 missense probably damaging 0.99
R5691:Ifi207 UTSW 1 173732426 missense unknown
R5838:Ifi207 UTSW 1 173732387 missense unknown
R6060:Ifi207 UTSW 1 173730527 missense unknown
R6220:Ifi207 UTSW 1 173729546 missense probably damaging 0.99
R6264:Ifi207 UTSW 1 173727545 missense probably damaging 1.00
R6307:Ifi207 UTSW 1 173725053 missense probably damaging 1.00
R6326:Ifi207 UTSW 1 173729966 missense probably benign 0.01
R6394:Ifi207 UTSW 1 173729015 missense probably benign 0.43
R6532:Ifi207 UTSW 1 173729645 missense possibly damaging 0.68
R6660:Ifi207 UTSW 1 173729406 missense probably benign 0.01
R6893:Ifi207 UTSW 1 173727642 missense possibly damaging 0.95
R7190:Ifi207 UTSW 1 173730252 missense unknown
R7192:Ifi207 UTSW 1 173729018 missense not run
R7194:Ifi207 UTSW 1 173729924 missense possibly damaging 0.84
R7327:Ifi207 UTSW 1 173729015 missense probably benign 0.43
R7348:Ifi207 UTSW 1 173729196 small deletion probably benign
R7404:Ifi207 UTSW 1 173728928 missense possibly damaging 0.92
R7442:Ifi207 UTSW 1 173727431 missense probably benign 0.03
R7784:Ifi207 UTSW 1 173730132 missense unknown
R8026:Ifi207 UTSW 1 173729196 small deletion probably benign
R8041:Ifi207 UTSW 1 173727702 missense possibly damaging 0.78
RF009:Ifi207 UTSW 1 173728992 missense probably benign 0.00
RF011:Ifi207 UTSW 1 173729121 missense not run
RF032:Ifi207 UTSW 1 173735157 small deletion probably benign
X0003:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0004:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0005:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0009:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0010:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0011:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0012:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0013:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0014:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0017:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0018:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0019:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0020:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0021:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0022:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0023:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0024:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0025:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0026:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0027:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0028:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0033:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0034:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0035:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0036:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0037:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0038:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0039:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0040:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0050:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0052:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0053:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0054:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0057:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0058:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0060:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0061:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0062:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0063:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0064:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0065:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0066:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
X0067:Ifi207 UTSW 1 173728982 missense probably damaging 0.98
Z1177:Ifi207 UTSW 1 173729579 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTTAACGTTCACATCAGAGACAC -3'
(R):5'- CTTCCTGTGGCAGCCTACTTAACAC -3'

Sequencing Primer
(F):5'- GACACAGGAAGCTCTGTATATCTC -3'
(R):5'- GGATTCAATTCCCAGAAGTGTG -3'
Posted On2014-04-13