Incidental Mutation 'R1533:Ndor1'
ID166712
Institutional Source Beutler Lab
Gene Symbol Ndor1
Ensembl Gene ENSMUSG00000006471
Gene NameNADPH dependent diflavin oxidoreductase 1
SynonymsNR1, 4930447P04Rik
MMRRC Submission 039572-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R1533 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25244821-25256022 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25249267 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 231 (S231P)
Ref Sequence ENSEMBL: ENSMUSP00000154261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100329] [ENSMUST00000114349] [ENSMUST00000132128] [ENSMUST00000147866] [ENSMUST00000148589] [ENSMUST00000228052] [ENSMUST00000228627]
Predicted Effect possibly damaging
Transcript: ENSMUST00000100329
AA Change: S233P

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097903
Gene: ENSMUSG00000006471
AA Change: S233P

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 8 124 2.3e-23 PFAM
Pfam:FAD_binding_1 134 354 8e-50 PFAM
Pfam:NAD_binding_1 389 495 2.1e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114349
AA Change: S300P

PolyPhen 2 Score 0.537 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109989
Gene: ENSMUSG00000006471
AA Change: S300P

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 8 145 2.3e-32 PFAM
Pfam:FAD_binding_1 201 421 2e-48 PFAM
Pfam:NAD_binding_1 456 561 1.7e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129705
Predicted Effect probably benign
Transcript: ENSMUST00000132128
SMART Domains Protein: ENSMUSP00000125018
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
PDB:4H2D|B 1 48 2e-9 PDB
SCOP:d1f4pa_ 4 57 4e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137355
Predicted Effect probably benign
Transcript: ENSMUST00000141808
SMART Domains Protein: ENSMUSP00000123247
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 7 120 8.1e-25 PFAM
Pfam:FAD_binding_1 167 225 9.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147866
SMART Domains Protein: ENSMUSP00000125259
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Pfam:Flavodoxin_1 93 196 4.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148589
SMART Domains Protein: ENSMUSP00000123958
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
PDB:4H2D|B 1 49 7e-10 PDB
SCOP:d1f4pa_ 4 45 3e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000228052
AA Change: S231P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000228627
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an NADPH-dependent diflavin reductase that contains both flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD) binding domains. The encoded protein catalyzes the transfer of electrons from NADPH through FAD and FMN cofactors to potential redox partners. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 37,041,375 G4509V probably damaging Het
Abca4 G C 3: 122,135,158 G1340A probably benign Het
Ambra1 T A 2: 91,886,865 Y836N probably damaging Het
Arhgap26 A T 18: 39,371,077 H144L probably benign Het
B3gnt5 A G 16: 19,769,614 I194M probably damaging Het
Bod1l A T 5: 41,822,155 C605* probably null Het
C2cd3 G T 7: 100,406,077 K482N possibly damaging Het
Ccdc114 T A 7: 45,942,858 M354K probably benign Het
Cd300lg T A 11: 102,043,221 L98Q probably damaging Het
Cerkl T A 2: 79,341,357 I386F possibly damaging Het
Cfh T A 1: 140,100,978 D466V possibly damaging Het
Crtc1 A T 8: 70,398,299 I221N probably damaging Het
Ctnnbl1 T C 2: 157,836,643 S389P probably benign Het
Ctsb A T 14: 63,139,095 D258V probably damaging Het
Cuzd1 G T 7: 131,311,703 T395N probably damaging Het
Dnah6 T C 6: 73,151,553 T1240A probably benign Het
Dok7 T A 5: 35,064,327 probably null Het
Dscaml1 T C 9: 45,450,584 V214A probably damaging Het
Enpp6 A T 8: 47,065,434 Y199F probably benign Het
Entpd5 C A 12: 84,394,660 K111N probably damaging Het
Fam98a A G 17: 75,541,281 L146S probably damaging Het
Fhod3 A T 18: 25,115,864 I1367F probably damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fpr3 T A 17: 17,970,660 Y64* probably null Het
Fzd6 A T 15: 39,031,624 H395L probably damaging Het
Gcsh T A 8: 116,989,182 H54L probably damaging Het
Gsdma T A 11: 98,676,384 S437T unknown Het
Gzmc A G 14: 56,233,919 V55A probably damaging Het
Hecw2 T A 1: 53,926,545 probably null Het
Ifi207 A G 1: 173,727,740 V792A probably benign Het
Itpr3 C A 17: 27,095,560 N661K possibly damaging Het
Jmy A T 13: 93,441,311 I783N probably benign Het
Kcmf1 T C 6: 72,843,020 E281G possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lgr6 T A 1: 135,104,932 Y70F possibly damaging Het
Lnx1 T G 5: 74,620,017 D330A probably damaging Het
Lrp5 T C 19: 3,614,234 N106S probably benign Het
Mamdc4 C A 2: 25,569,747 R135L possibly damaging Het
Mcm3ap A G 10: 76,504,287 E1464G probably damaging Het
Megf8 T C 7: 25,334,855 V666A possibly damaging Het
Mettl3 T A 14: 52,296,928 E331D probably benign Het
Mphosph9 T C 5: 124,267,141 K789R probably damaging Het
Mtf2 T C 5: 108,092,129 L234P probably damaging Het
Ncdn C A 4: 126,748,698 E389* probably null Het
Nelfa T G 5: 33,898,871 K483Q probably damaging Het
Olfr311 A G 11: 58,841,966 N284S probably damaging Het
Olfr538 T A 7: 140,575,121 probably null Het
Opn1sw C T 6: 29,378,924 R243Q probably benign Het
Pik3cd T C 4: 149,655,196 E584G probably damaging Het
Plcb3 A T 19: 6,957,673 M870K possibly damaging Het
Poc5 A G 13: 96,391,644 D16G probably damaging Het
Prpf40a A G 2: 53,145,840 I633T probably damaging Het
Ptpn13 G T 5: 103,556,178 E1359* probably null Het
Ptprr C A 10: 116,188,208 Y4* probably null Het
Rbm45 T C 2: 76,372,159 probably null Het
Rfng C T 11: 120,781,861 W320* probably null Het
Rgs6 G T 12: 83,091,773 V294L probably benign Het
Rufy4 T C 1: 74,129,843 probably null Het
Ruvbl2 T A 7: 45,424,142 N313I probably damaging Het
Sema4g G A 19: 44,992,817 V70M probably damaging Het
Siglec1 T C 2: 131,076,158 T969A probably benign Het
Slc22a27 T A 19: 7,866,983 T431S possibly damaging Het
Slc25a16 G A 10: 62,920,864 R38H probably damaging Het
Slc38a6 T C 12: 73,344,852 V296A probably benign Het
Slc39a11 C T 11: 113,305,922 V212I probably damaging Het
Sltm A G 9: 70,586,666 K782E probably damaging Het
Styxl1 T A 5: 135,770,321 Y23F probably damaging Het
Svs4 T C 2: 164,278,228 I20V unknown Het
Syt14 G T 1: 192,930,776 T572K possibly damaging Het
Tbc1d5 A T 17: 50,920,575 I214N possibly damaging Het
Tm9sf3 A G 19: 41,238,784 S283P probably benign Het
Tmtc1 C T 6: 148,245,710 probably null Het
Ttll7 T A 3: 146,896,667 N73K probably damaging Het
Ttn T A 2: 76,772,458 K18473N probably damaging Het
Ubr2 A C 17: 46,967,247 Y721* probably null Het
Vmn1r14 T A 6: 57,234,301 I288N probably damaging Het
Vmn2r103 T C 17: 19,773,400 I13T probably benign Het
Vps13a A T 19: 16,701,130 Y1162* probably null Het
Vps51 C A 19: 6,071,467 R175L probably benign Het
Zfp523 C A 17: 28,204,499 S149R probably benign Het
Zik1 A G 7: 10,490,126 I348T possibly damaging Het
Znfx1 T A 2: 167,056,788 H72L probably benign Het
Other mutations in Ndor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Ndor1 APN 2 25250139 missense probably benign 0.05
IGL02174:Ndor1 APN 2 25249194 missense possibly damaging 0.49
IGL02366:Ndor1 APN 2 25247981 missense possibly damaging 0.94
IGL02407:Ndor1 APN 2 25249269 missense probably benign 0.39
IGL02630:Ndor1 APN 2 25255287 missense probably damaging 1.00
R0139:Ndor1 UTSW 2 25248354 missense possibly damaging 0.90
R0194:Ndor1 UTSW 2 25248706 unclassified probably null
R0926:Ndor1 UTSW 2 25248348 missense probably benign 0.08
R1530:Ndor1 UTSW 2 25248909 missense probably benign 0.02
R1837:Ndor1 UTSW 2 25248396 missense probably damaging 1.00
R1954:Ndor1 UTSW 2 25255293 missense possibly damaging 0.86
R1981:Ndor1 UTSW 2 25255224 missense probably damaging 0.97
R2090:Ndor1 UTSW 2 25249218 missense probably damaging 1.00
R2188:Ndor1 UTSW 2 25251753 unclassified probably null
R3433:Ndor1 UTSW 2 25247811 missense possibly damaging 0.91
R3620:Ndor1 UTSW 2 25248035 missense probably damaging 1.00
R4013:Ndor1 UTSW 2 25250150 missense probably damaging 0.98
R4411:Ndor1 UTSW 2 25248480 missense probably benign 0.08
R4457:Ndor1 UTSW 2 25248116 unclassified probably null
R4942:Ndor1 UTSW 2 25248121 critical splice donor site probably null
R5132:Ndor1 UTSW 2 25247769 missense probably benign 0.28
R6476:Ndor1 UTSW 2 25248142 missense possibly damaging 0.95
R6702:Ndor1 UTSW 2 25249890 missense possibly damaging 0.95
R6703:Ndor1 UTSW 2 25249890 missense possibly damaging 0.95
R8016:Ndor1 UTSW 2 25249317 missense probably benign 0.00
X0018:Ndor1 UTSW 2 25247844 missense probably benign 0.03
X0019:Ndor1 UTSW 2 25248181 missense probably damaging 1.00
Z1177:Ndor1 UTSW 2 25247789 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCTAAAGCACTCCTGCCTACTACC -3'
(R):5'- AAGTGTTGTGCCTGGACCCCAATC -3'

Sequencing Primer
(F):5'- TCGCATAGCACCTGGATAAATG -3'
(R):5'- ATCAGTTTTTCACACTTAAGCCACG -3'
Posted On2014-04-13