Incidental Mutation 'R1533:Ambra1'
ID166720
Institutional Source Beutler Lab
Gene Symbol Ambra1
Ensembl Gene ENSMUSG00000040506
Gene Nameautophagy/beclin 1 regulator 1
Synonyms2310079H06Rik, D030051N19Rik
MMRRC Submission 039572-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R1533 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location91730134-91918849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91886865 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 836 (Y836N)
Ref Sequence ENSEMBL: ENSMUSP00000106949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045699] [ENSMUST00000045705] [ENSMUST00000099712] [ENSMUST00000111316] [ENSMUST00000111317]
Predicted Effect probably damaging
Transcript: ENSMUST00000045699
AA Change: Y836N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048898
Gene: ENSMUSG00000040506
AA Change: Y836N

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
low complexity region 636 643 N/A INTRINSIC
Blast:WD40 812 850 1e-5 BLAST
Blast:WD40 871 918 1e-7 BLAST
low complexity region 942 954 N/A INTRINSIC
low complexity region 1002 1026 N/A INTRINSIC
low complexity region 1127 1143 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000045705
AA Change: Y956N

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000049258
Gene: ENSMUSG00000040506
AA Change: Y956N

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 267 285 N/A INTRINSIC
low complexity region 442 452 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 682 704 N/A INTRINSIC
low complexity region 756 763 N/A INTRINSIC
Blast:WD40 932 970 1e-5 BLAST
Blast:WD40 991 1038 1e-7 BLAST
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1122 1146 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099712
AA Change: Y865N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097299
Gene: ENSMUSG00000040506
AA Change: Y865N

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
low complexity region 591 613 N/A INTRINSIC
low complexity region 665 672 N/A INTRINSIC
Blast:WD40 841 879 1e-5 BLAST
Blast:WD40 900 947 1e-7 BLAST
low complexity region 971 983 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
low complexity region 1156 1172 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111316
AA Change: Y896N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106948
Gene: ENSMUSG00000040506
AA Change: Y896N

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 267 285 N/A INTRINSIC
low complexity region 442 452 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
low complexity region 629 645 N/A INTRINSIC
low complexity region 682 704 N/A INTRINSIC
Blast:WD40 872 910 1e-5 BLAST
Blast:WD40 931 978 1e-7 BLAST
low complexity region 1002 1014 N/A INTRINSIC
low complexity region 1062 1086 N/A INTRINSIC
low complexity region 1187 1203 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111317
AA Change: Y836N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106949
Gene: ENSMUSG00000040506
AA Change: Y836N

DomainStartEndE-ValueType
WD40 50 81 4.11e1 SMART
WD40 84 124 1.16e-9 SMART
WD40 126 164 1.19e0 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
low complexity region 636 643 N/A INTRINSIC
Blast:WD40 812 850 1e-5 BLAST
Blast:WD40 871 918 1e-7 BLAST
low complexity region 942 954 N/A INTRINSIC
low complexity region 1002 1026 N/A INTRINSIC
low complexity region 1127 1143 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Most mice homozygous for a gene trap mutation die at E10-E14.5 with severe neural tube defects manifest as midbrain/hindbrain exencephaly and/or spina bifida and associated with impaired autophagy, accumulation of ubiquitinated proteins, abnormal cell proliferation and excessive apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 37,041,375 G4509V probably damaging Het
Abca4 G C 3: 122,135,158 G1340A probably benign Het
Arhgap26 A T 18: 39,371,077 H144L probably benign Het
B3gnt5 A G 16: 19,769,614 I194M probably damaging Het
Bod1l A T 5: 41,822,155 C605* probably null Het
C2cd3 G T 7: 100,406,077 K482N possibly damaging Het
Ccdc114 T A 7: 45,942,858 M354K probably benign Het
Cd300lg T A 11: 102,043,221 L98Q probably damaging Het
Cerkl T A 2: 79,341,357 I386F possibly damaging Het
Cfh T A 1: 140,100,978 D466V possibly damaging Het
Crtc1 A T 8: 70,398,299 I221N probably damaging Het
Ctnnbl1 T C 2: 157,836,643 S389P probably benign Het
Ctsb A T 14: 63,139,095 D258V probably damaging Het
Cuzd1 G T 7: 131,311,703 T395N probably damaging Het
Dnah6 T C 6: 73,151,553 T1240A probably benign Het
Dok7 T A 5: 35,064,327 probably null Het
Dscaml1 T C 9: 45,450,584 V214A probably damaging Het
Enpp6 A T 8: 47,065,434 Y199F probably benign Het
Entpd5 C A 12: 84,394,660 K111N probably damaging Het
Fam98a A G 17: 75,541,281 L146S probably damaging Het
Fhod3 A T 18: 25,115,864 I1367F probably damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fpr3 T A 17: 17,970,660 Y64* probably null Het
Fzd6 A T 15: 39,031,624 H395L probably damaging Het
Gcsh T A 8: 116,989,182 H54L probably damaging Het
Gsdma T A 11: 98,676,384 S437T unknown Het
Gzmc A G 14: 56,233,919 V55A probably damaging Het
Hecw2 T A 1: 53,926,545 probably null Het
Ifi207 A G 1: 173,727,740 V792A probably benign Het
Itpr3 C A 17: 27,095,560 N661K possibly damaging Het
Jmy A T 13: 93,441,311 I783N probably benign Het
Kcmf1 T C 6: 72,843,020 E281G possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lgr6 T A 1: 135,104,932 Y70F possibly damaging Het
Lnx1 T G 5: 74,620,017 D330A probably damaging Het
Lrp5 T C 19: 3,614,234 N106S probably benign Het
Mamdc4 C A 2: 25,569,747 R135L possibly damaging Het
Mcm3ap A G 10: 76,504,287 E1464G probably damaging Het
Megf8 T C 7: 25,334,855 V666A possibly damaging Het
Mettl3 T A 14: 52,296,928 E331D probably benign Het
Mphosph9 T C 5: 124,267,141 K789R probably damaging Het
Mtf2 T C 5: 108,092,129 L234P probably damaging Het
Ncdn C A 4: 126,748,698 E389* probably null Het
Ndor1 A G 2: 25,249,267 S231P probably damaging Het
Nelfa T G 5: 33,898,871 K483Q probably damaging Het
Olfr311 A G 11: 58,841,966 N284S probably damaging Het
Olfr538 T A 7: 140,575,121 probably null Het
Opn1sw C T 6: 29,378,924 R243Q probably benign Het
Pik3cd T C 4: 149,655,196 E584G probably damaging Het
Plcb3 A T 19: 6,957,673 M870K possibly damaging Het
Poc5 A G 13: 96,391,644 D16G probably damaging Het
Prpf40a A G 2: 53,145,840 I633T probably damaging Het
Ptpn13 G T 5: 103,556,178 E1359* probably null Het
Ptprr C A 10: 116,188,208 Y4* probably null Het
Rbm45 T C 2: 76,372,159 probably null Het
Rfng C T 11: 120,781,861 W320* probably null Het
Rgs6 G T 12: 83,091,773 V294L probably benign Het
Rufy4 T C 1: 74,129,843 probably null Het
Ruvbl2 T A 7: 45,424,142 N313I probably damaging Het
Sema4g G A 19: 44,992,817 V70M probably damaging Het
Siglec1 T C 2: 131,076,158 T969A probably benign Het
Slc22a27 T A 19: 7,866,983 T431S possibly damaging Het
Slc25a16 G A 10: 62,920,864 R38H probably damaging Het
Slc38a6 T C 12: 73,344,852 V296A probably benign Het
Slc39a11 C T 11: 113,305,922 V212I probably damaging Het
Sltm A G 9: 70,586,666 K782E probably damaging Het
Styxl1 T A 5: 135,770,321 Y23F probably damaging Het
Svs4 T C 2: 164,278,228 I20V unknown Het
Syt14 G T 1: 192,930,776 T572K possibly damaging Het
Tbc1d5 A T 17: 50,920,575 I214N possibly damaging Het
Tm9sf3 A G 19: 41,238,784 S283P probably benign Het
Tmtc1 C T 6: 148,245,710 probably null Het
Ttll7 T A 3: 146,896,667 N73K probably damaging Het
Ttn T A 2: 76,772,458 K18473N probably damaging Het
Ubr2 A C 17: 46,967,247 Y721* probably null Het
Vmn1r14 T A 6: 57,234,301 I288N probably damaging Het
Vmn2r103 T C 17: 19,773,400 I13T probably benign Het
Vps13a A T 19: 16,701,130 Y1162* probably null Het
Vps51 C A 19: 6,071,467 R175L probably benign Het
Zfp523 C A 17: 28,204,499 S149R probably benign Het
Zik1 A G 7: 10,490,126 I348T possibly damaging Het
Znfx1 T A 2: 167,056,788 H72L probably benign Het
Other mutations in Ambra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ambra1 APN 2 91911589 missense probably benign 0.01
IGL00861:Ambra1 APN 2 91770926 missense possibly damaging 0.81
IGL00911:Ambra1 APN 2 91767682 splice site probably benign
IGL01371:Ambra1 APN 2 91825286 missense probably damaging 1.00
IGL01532:Ambra1 APN 2 91885632 missense probably damaging 1.00
IGL01620:Ambra1 APN 2 91911412 critical splice acceptor site probably null
IGL02147:Ambra1 APN 2 91767719 missense probably benign 0.01
IGL02170:Ambra1 APN 2 91767087 missense possibly damaging 0.66
IGL02173:Ambra1 APN 2 91917668 missense probably benign
IGL02212:Ambra1 APN 2 91917361 missense probably damaging 1.00
IGL02256:Ambra1 APN 2 91769054 missense possibly damaging 0.95
IGL02319:Ambra1 APN 2 91886920 missense probably damaging 1.00
IGL02502:Ambra1 APN 2 91900532 missense probably damaging 1.00
IGL02961:Ambra1 APN 2 91911448 missense possibly damaging 0.86
R0003:Ambra1 UTSW 2 91911428 missense probably damaging 1.00
R0098:Ambra1 UTSW 2 91767711 missense possibly damaging 0.66
R0173:Ambra1 UTSW 2 91810219 splice site probably benign
R0414:Ambra1 UTSW 2 91875739 missense possibly damaging 0.84
R0579:Ambra1 UTSW 2 91824465 missense possibly damaging 0.66
R1212:Ambra1 UTSW 2 91769036 missense possibly damaging 0.94
R1241:Ambra1 UTSW 2 91770896 splice site probably benign
R1467:Ambra1 UTSW 2 91885703 missense probably damaging 1.00
R1467:Ambra1 UTSW 2 91885703 missense probably damaging 1.00
R1916:Ambra1 UTSW 2 91911461 missense probably damaging 1.00
R2080:Ambra1 UTSW 2 91885719 missense probably damaging 1.00
R2083:Ambra1 UTSW 2 91766600 missense possibly damaging 0.83
R2112:Ambra1 UTSW 2 91875787 missense probably damaging 1.00
R2255:Ambra1 UTSW 2 91917461 missense probably damaging 1.00
R3407:Ambra1 UTSW 2 91910307 missense probably damaging 1.00
R3732:Ambra1 UTSW 2 91810131 missense probably damaging 1.00
R4111:Ambra1 UTSW 2 91900558 missense probably damaging 1.00
R4792:Ambra1 UTSW 2 91772846 missense possibly damaging 0.66
R4879:Ambra1 UTSW 2 91772694 intron probably benign
R5007:Ambra1 UTSW 2 91772310 missense possibly damaging 0.79
R5261:Ambra1 UTSW 2 91885606 missense probably damaging 1.00
R6141:Ambra1 UTSW 2 91875754 missense probably damaging 1.00
R6364:Ambra1 UTSW 2 91773316 missense possibly damaging 0.66
R6413:Ambra1 UTSW 2 91769084 missense possibly damaging 0.92
R6868:Ambra1 UTSW 2 91917533 missense possibly damaging 0.83
R6888:Ambra1 UTSW 2 91769027 missense probably damaging 1.00
R6964:Ambra1 UTSW 2 91917416 nonsense probably null
R6970:Ambra1 UTSW 2 91772600 intron probably benign
R6982:Ambra1 UTSW 2 91917473 missense probably damaging 1.00
R7205:Ambra1 UTSW 2 91767758 missense possibly damaging 0.46
R7458:Ambra1 UTSW 2 91917684 missense probably benign 0.26
R7786:Ambra1 UTSW 2 91767796 missense possibly damaging 0.46
R7812:Ambra1 UTSW 2 91766566 start codon destroyed probably benign 0.00
R7825:Ambra1 UTSW 2 91767761 missense probably damaging 1.00
R7860:Ambra1 UTSW 2 91773493 missense probably benign 0.27
R7943:Ambra1 UTSW 2 91773493 missense probably benign 0.27
Z1177:Ambra1 UTSW 2 91768999 missense possibly damaging 0.81
Z1177:Ambra1 UTSW 2 91875786 missense probably damaging 0.97
Z1177:Ambra1 UTSW 2 91900608 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GTGCCAATTGTTCACCACACTACAC -3'
(R):5'- TCACTCACACGCAAGGCAAGTATG -3'

Sequencing Primer
(F):5'- TGCACACTGCAACCCTAGAAG -3'
(R):5'- AAAGTTCCTGGTCATGGGTCAC -3'
Posted On2014-04-13