Incidental Mutation 'R1533:Siglec1'
ID166721
Institutional Source Beutler Lab
Gene Symbol Siglec1
Ensembl Gene ENSMUSG00000027322
Gene Namesialic acid binding Ig-like lectin 1, sialoadhesin
SynonymsSn, CD169, Siglec-1
MMRRC Submission 039572-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1533 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location131069220-131086765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 131076158 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 969 (T969A)
Ref Sequence ENSEMBL: ENSMUSP00000105856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028794] [ENSMUST00000110227]
Predicted Effect probably benign
Transcript: ENSMUST00000028794
AA Change: T969A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028794
Gene: ENSMUSG00000027322
AA Change: T969A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 32 142 2.92e-5 SMART
Pfam:C2-set_2 148 235 9.4e-18 PFAM
IGc2 260 319 8.78e-9 SMART
IGc2 344 404 4.07e-4 SMART
IGc2 431 505 3.3e-4 SMART
IGc2 529 589 5.75e-4 SMART
IGc2 622 698 3.54e-4 SMART
low complexity region 700 705 N/A INTRINSIC
IG 716 795 3.35e-5 SMART
IG 804 896 6.51e-3 SMART
IGc2 909 969 4.13e-5 SMART
IG_like 1001 1076 6.78e-2 SMART
low complexity region 1077 1088 N/A INTRINSIC
IG 1094 1171 4.32e-8 SMART
IG_like 1185 1250 1.94e-2 SMART
IG 1268 1345 1.36e-5 SMART
IG_like 1354 1447 1.45e1 SMART
IG_like 1365 1435 4.51e-2 SMART
IG 1454 1534 4.56e-7 SMART
IG_like 1549 1624 1.21e-1 SMART
transmembrane domain 1647 1669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110227
AA Change: T969A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105856
Gene: ENSMUSG00000027322
AA Change: T969A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 32 142 2.92e-5 SMART
Pfam:C2-set_2 148 235 7e-17 PFAM
IGc2 260 319 8.78e-9 SMART
IGc2 344 404 4.07e-4 SMART
IGc2 431 505 3.3e-4 SMART
IGc2 529 589 5.75e-4 SMART
IGc2 622 698 3.54e-4 SMART
low complexity region 700 705 N/A INTRINSIC
IG 716 795 3.35e-5 SMART
IG 804 896 6.51e-3 SMART
IGc2 909 969 4.13e-5 SMART
IG_like 1001 1076 6.78e-2 SMART
low complexity region 1077 1088 N/A INTRINSIC
IG 1094 1171 4.32e-8 SMART
IG_like 1185 1250 1.94e-2 SMART
IG 1268 1345 1.36e-5 SMART
IG_like 1354 1447 1.45e1 SMART
IG_like 1365 1435 4.51e-2 SMART
IG 1454 1534 4.56e-7 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded protein is a lectin-like adhesion molecule that binds glycoconjugate ligands on cell surfaces in a sialic acid-dependent manner. It is a type I transmembrane protein expressed only by a subpopulation of macrophages and is involved in mediating cell-cell interactions. Alternative splicing produces a transcript variant encoding an isoform that is soluble rather than membrane-bound; however, the full-length nature of this variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene display subtle changes in B- and T-cell populations and decreased IgM levels. Mice homozygous for a knock-out or knock-in allele exhibit impaired phagocytosis of sialylated C. jejuni. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 37,041,375 G4509V probably damaging Het
Abca4 G C 3: 122,135,158 G1340A probably benign Het
Ambra1 T A 2: 91,886,865 Y836N probably damaging Het
Arhgap26 A T 18: 39,371,077 H144L probably benign Het
B3gnt5 A G 16: 19,769,614 I194M probably damaging Het
Bod1l A T 5: 41,822,155 C605* probably null Het
C2cd3 G T 7: 100,406,077 K482N possibly damaging Het
Ccdc114 T A 7: 45,942,858 M354K probably benign Het
Cd300lg T A 11: 102,043,221 L98Q probably damaging Het
Cerkl T A 2: 79,341,357 I386F possibly damaging Het
Cfh T A 1: 140,100,978 D466V possibly damaging Het
Crtc1 A T 8: 70,398,299 I221N probably damaging Het
Ctnnbl1 T C 2: 157,836,643 S389P probably benign Het
Ctsb A T 14: 63,139,095 D258V probably damaging Het
Cuzd1 G T 7: 131,311,703 T395N probably damaging Het
Dnah6 T C 6: 73,151,553 T1240A probably benign Het
Dok7 T A 5: 35,064,327 probably null Het
Dscaml1 T C 9: 45,450,584 V214A probably damaging Het
Enpp6 A T 8: 47,065,434 Y199F probably benign Het
Entpd5 C A 12: 84,394,660 K111N probably damaging Het
Fam98a A G 17: 75,541,281 L146S probably damaging Het
Fhod3 A T 18: 25,115,864 I1367F probably damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fpr3 T A 17: 17,970,660 Y64* probably null Het
Fzd6 A T 15: 39,031,624 H395L probably damaging Het
Gcsh T A 8: 116,989,182 H54L probably damaging Het
Gsdma T A 11: 98,676,384 S437T unknown Het
Gzmc A G 14: 56,233,919 V55A probably damaging Het
Hecw2 T A 1: 53,926,545 probably null Het
Ifi207 A G 1: 173,727,740 V792A probably benign Het
Itpr3 C A 17: 27,095,560 N661K possibly damaging Het
Jmy A T 13: 93,441,311 I783N probably benign Het
Kcmf1 T C 6: 72,843,020 E281G possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lgr6 T A 1: 135,104,932 Y70F possibly damaging Het
Lnx1 T G 5: 74,620,017 D330A probably damaging Het
Lrp5 T C 19: 3,614,234 N106S probably benign Het
Mamdc4 C A 2: 25,569,747 R135L possibly damaging Het
Mcm3ap A G 10: 76,504,287 E1464G probably damaging Het
Megf8 T C 7: 25,334,855 V666A possibly damaging Het
Mettl3 T A 14: 52,296,928 E331D probably benign Het
Mphosph9 T C 5: 124,267,141 K789R probably damaging Het
Mtf2 T C 5: 108,092,129 L234P probably damaging Het
Ncdn C A 4: 126,748,698 E389* probably null Het
Ndor1 A G 2: 25,249,267 S231P probably damaging Het
Nelfa T G 5: 33,898,871 K483Q probably damaging Het
Olfr311 A G 11: 58,841,966 N284S probably damaging Het
Olfr538 T A 7: 140,575,121 probably null Het
Opn1sw C T 6: 29,378,924 R243Q probably benign Het
Pik3cd T C 4: 149,655,196 E584G probably damaging Het
Plcb3 A T 19: 6,957,673 M870K possibly damaging Het
Poc5 A G 13: 96,391,644 D16G probably damaging Het
Prpf40a A G 2: 53,145,840 I633T probably damaging Het
Ptpn13 G T 5: 103,556,178 E1359* probably null Het
Ptprr C A 10: 116,188,208 Y4* probably null Het
Rbm45 T C 2: 76,372,159 probably null Het
Rfng C T 11: 120,781,861 W320* probably null Het
Rgs6 G T 12: 83,091,773 V294L probably benign Het
Rufy4 T C 1: 74,129,843 probably null Het
Ruvbl2 T A 7: 45,424,142 N313I probably damaging Het
Sema4g G A 19: 44,992,817 V70M probably damaging Het
Slc22a27 T A 19: 7,866,983 T431S possibly damaging Het
Slc25a16 G A 10: 62,920,864 R38H probably damaging Het
Slc38a6 T C 12: 73,344,852 V296A probably benign Het
Slc39a11 C T 11: 113,305,922 V212I probably damaging Het
Sltm A G 9: 70,586,666 K782E probably damaging Het
Styxl1 T A 5: 135,770,321 Y23F probably damaging Het
Svs4 T C 2: 164,278,228 I20V unknown Het
Syt14 G T 1: 192,930,776 T572K possibly damaging Het
Tbc1d5 A T 17: 50,920,575 I214N possibly damaging Het
Tm9sf3 A G 19: 41,238,784 S283P probably benign Het
Tmtc1 C T 6: 148,245,710 probably null Het
Ttll7 T A 3: 146,896,667 N73K probably damaging Het
Ttn T A 2: 76,772,458 K18473N probably damaging Het
Ubr2 A C 17: 46,967,247 Y721* probably null Het
Vmn1r14 T A 6: 57,234,301 I288N probably damaging Het
Vmn2r103 T C 17: 19,773,400 I13T probably benign Het
Vps13a A T 19: 16,701,130 Y1162* probably null Het
Vps51 C A 19: 6,071,467 R175L probably benign Het
Zfp523 C A 17: 28,204,499 S149R probably benign Het
Zik1 A G 7: 10,490,126 I348T possibly damaging Het
Znfx1 T A 2: 167,056,788 H72L probably benign Het
Other mutations in Siglec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Siglec1 APN 2 131079325 missense probably benign 0.03
IGL01092:Siglec1 APN 2 131079217 missense probably damaging 1.00
IGL01115:Siglec1 APN 2 131074502 missense probably benign 0.01
IGL01324:Siglec1 APN 2 131085541 missense probably damaging 1.00
IGL01330:Siglec1 APN 2 131083536 missense probably damaging 1.00
IGL01330:Siglec1 APN 2 131075005 nonsense probably null
IGL01558:Siglec1 APN 2 131078499 missense probably damaging 0.96
IGL01632:Siglec1 APN 2 131083820 missense probably benign 0.03
IGL01768:Siglec1 APN 2 131074394 missense probably benign
IGL02399:Siglec1 APN 2 131071178 missense probably benign 0.16
IGL02558:Siglec1 APN 2 131074995 missense possibly damaging 0.88
IGL02794:Siglec1 APN 2 131075969 missense possibly damaging 0.86
IGL02839:Siglec1 APN 2 131084932 missense possibly damaging 0.82
K3955:Siglec1 UTSW 2 131081439 missense probably benign 0.00
P0038:Siglec1 UTSW 2 131081439 missense probably benign 0.00
PIT4576001:Siglec1 UTSW 2 131078161 missense probably damaging 1.00
PIT4677001:Siglec1 UTSW 2 131072757 missense probably damaging 1.00
R0003:Siglec1 UTSW 2 131075060 missense probably benign 0.00
R0048:Siglec1 UTSW 2 131073397 missense possibly damaging 0.65
R0048:Siglec1 UTSW 2 131073397 missense possibly damaging 0.65
R0243:Siglec1 UTSW 2 131085476 missense probably damaging 1.00
R0276:Siglec1 UTSW 2 131083941 nonsense probably null
R0379:Siglec1 UTSW 2 131074525 splice site probably benign
R0464:Siglec1 UTSW 2 131079359 missense probably damaging 1.00
R0507:Siglec1 UTSW 2 131074525 splice site probably benign
R0560:Siglec1 UTSW 2 131070346 missense probably benign 0.02
R0620:Siglec1 UTSW 2 131074268 missense probably benign 0.30
R0621:Siglec1 UTSW 2 131074268 missense probably benign 0.30
R0853:Siglec1 UTSW 2 131085022 missense probably damaging 0.98
R1079:Siglec1 UTSW 2 131079377 nonsense probably null
R1169:Siglec1 UTSW 2 131074827 missense probably damaging 0.97
R1205:Siglec1 UTSW 2 131080464 missense possibly damaging 0.94
R1293:Siglec1 UTSW 2 131073531 missense probably benign 0.00
R1470:Siglec1 UTSW 2 131070387 missense probably benign 0.19
R1470:Siglec1 UTSW 2 131070387 missense probably benign 0.19
R1717:Siglec1 UTSW 2 131073956 missense possibly damaging 0.92
R1717:Siglec1 UTSW 2 131084012 missense probably damaging 1.00
R1744:Siglec1 UTSW 2 131081299 missense probably damaging 1.00
R1852:Siglec1 UTSW 2 131081500 missense probably damaging 0.98
R1941:Siglec1 UTSW 2 131078131 missense possibly damaging 0.94
R2011:Siglec1 UTSW 2 131083357 missense probably damaging 1.00
R2012:Siglec1 UTSW 2 131083357 missense probably damaging 1.00
R2128:Siglec1 UTSW 2 131080497 missense probably damaging 1.00
R2278:Siglec1 UTSW 2 131071337 missense probably benign 0.28
R2403:Siglec1 UTSW 2 131074475 missense possibly damaging 0.65
R2449:Siglec1 UTSW 2 131078725 missense probably benign 0.44
R2885:Siglec1 UTSW 2 131072747 missense possibly damaging 0.88
R4213:Siglec1 UTSW 2 131074118 missense probably damaging 1.00
R4274:Siglec1 UTSW 2 131085814 missense probably benign 0.00
R4679:Siglec1 UTSW 2 131073411 missense possibly damaging 0.87
R4715:Siglec1 UTSW 2 131074436 missense probably damaging 1.00
R4782:Siglec1 UTSW 2 131075923 missense probably damaging 1.00
R4896:Siglec1 UTSW 2 131069869 missense probably benign 0.21
R4993:Siglec1 UTSW 2 131073361 missense possibly damaging 0.93
R5004:Siglec1 UTSW 2 131069869 missense probably benign 0.21
R5004:Siglec1 UTSW 2 131073411 missense possibly damaging 0.87
R5105:Siglec1 UTSW 2 131080400 missense possibly damaging 0.69
R5137:Siglec1 UTSW 2 131081344 missense probably damaging 1.00
R5153:Siglec1 UTSW 2 131085577 missense probably damaging 0.99
R5311:Siglec1 UTSW 2 131079316 missense probably damaging 1.00
R5600:Siglec1 UTSW 2 131085583 missense probably benign 0.01
R5682:Siglec1 UTSW 2 131084010 missense probably damaging 1.00
R5732:Siglec1 UTSW 2 131074268 missense probably benign 0.30
R5870:Siglec1 UTSW 2 131072847 missense probably damaging 0.99
R5898:Siglec1 UTSW 2 131073633 missense probably damaging 1.00
R5909:Siglec1 UTSW 2 131077964 missense probably damaging 1.00
R6488:Siglec1 UTSW 2 131081307 missense probably damaging 0.99
R6920:Siglec1 UTSW 2 131078077 nonsense probably null
R7064:Siglec1 UTSW 2 131083914 missense probably benign 0.00
R7270:Siglec1 UTSW 2 131081551 missense possibly damaging 0.67
R7355:Siglec1 UTSW 2 131080451 missense probably benign 0.02
R7400:Siglec1 UTSW 2 131086095 missense possibly damaging 0.73
R7470:Siglec1 UTSW 2 131075824 missense probably benign 0.00
R7568:Siglec1 UTSW 2 131072682 missense probably damaging 1.00
R7781:Siglec1 UTSW 2 131081338 missense probably damaging 1.00
R7853:Siglec1 UTSW 2 131081292 missense probably damaging 1.00
R7936:Siglec1 UTSW 2 131081292 missense probably damaging 1.00
R7999:Siglec1 UTSW 2 131071163 missense probably benign 0.28
X0024:Siglec1 UTSW 2 131080491 missense probably damaging 1.00
Z1176:Siglec1 UTSW 2 131078745 missense probably damaging 0.99
Z1176:Siglec1 UTSW 2 131080524 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGGGTCACTTTGTACACTGCACAC -3'
(R):5'- TCCAGGTTTCACCATCACCTGAGC -3'

Sequencing Primer
(F):5'- TACACTGCACACCAGGTGG -3'
(R):5'- ATACAGCTGGTATCAGGATGGC -3'
Posted On2014-04-13