Incidental Mutation 'R1533:Ttll7'
ID 166727
Institutional Source Beutler Lab
Gene Symbol Ttll7
Ensembl Gene ENSMUSG00000036745
Gene Name tubulin tyrosine ligase-like family, member 7
Synonyms 1110049N09Rik, 4921517B04Rik
MMRRC Submission 039572-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.538) question?
Stock # R1533 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 146558122-146689764 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 146602422 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 73 (N73K)
Ref Sequence ENSEMBL: ENSMUSP00000043753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037942] [ENSMUST00000106134] [ENSMUST00000124743] [ENSMUST00000170055]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000037942
AA Change: N73K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000038090
SMART Domains Protein: ENSMUSP00000037875
Gene: ENSMUSG00000036745

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 9e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106134
AA Change: N73K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101740
Gene: ENSMUSG00000036745
AA Change: N73K

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 7.2e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124743
AA Change: N4K

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000170055
AA Change: N73K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129369
Gene: ENSMUSG00000036745
AA Change: N73K

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 5.9e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G C 3: 121,928,807 (GRCm39) G1340A probably benign Het
Ambra1 T A 2: 91,717,210 (GRCm39) Y836N probably damaging Het
Arhgap26 A T 18: 39,504,130 (GRCm39) H144L probably benign Het
B3gnt5 A G 16: 19,588,364 (GRCm39) I194M probably damaging Het
Bltp1 G T 3: 37,095,524 (GRCm39) G4509V probably damaging Het
Bod1l A T 5: 41,979,498 (GRCm39) C605* probably null Het
C2cd3 G T 7: 100,055,284 (GRCm39) K482N possibly damaging Het
Cd300lg T A 11: 101,934,047 (GRCm39) L98Q probably damaging Het
Cerkl T A 2: 79,171,701 (GRCm39) I386F possibly damaging Het
Cfh T A 1: 140,028,716 (GRCm39) D466V possibly damaging Het
Crtc1 A T 8: 70,850,949 (GRCm39) I221N probably damaging Het
Ctnnbl1 T C 2: 157,678,563 (GRCm39) S389P probably benign Het
Ctsb A T 14: 63,376,544 (GRCm39) D258V probably damaging Het
Cuzd1 G T 7: 130,913,432 (GRCm39) T395N probably damaging Het
Dnah6 T C 6: 73,128,536 (GRCm39) T1240A probably benign Het
Dok7 T A 5: 35,221,671 (GRCm39) probably null Het
Dscaml1 T C 9: 45,361,882 (GRCm39) V214A probably damaging Het
Enpp6 A T 8: 47,518,469 (GRCm39) Y199F probably benign Het
Entpd5 C A 12: 84,441,434 (GRCm39) K111N probably damaging Het
Fam98a A G 17: 75,848,276 (GRCm39) L146S probably damaging Het
Fhod3 A T 18: 25,248,921 (GRCm39) I1367F probably damaging Het
Fmnl2 A G 2: 52,995,549 (GRCm39) E424G probably damaging Het
Fpr3 T A 17: 18,190,922 (GRCm39) Y64* probably null Het
Fzd6 A T 15: 38,895,019 (GRCm39) H395L probably damaging Het
Gcsh T A 8: 117,715,921 (GRCm39) H54L probably damaging Het
Gsdma T A 11: 98,567,210 (GRCm39) S437T unknown Het
Gzmc A G 14: 56,471,376 (GRCm39) V55A probably damaging Het
Hecw2 T A 1: 53,965,704 (GRCm39) probably null Het
Ifi207 A G 1: 173,555,306 (GRCm39) V792A probably benign Het
Itpr3 C A 17: 27,314,534 (GRCm39) N661K possibly damaging Het
Jmy A T 13: 93,577,819 (GRCm39) I783N probably benign Het
Kcmf1 T C 6: 72,820,003 (GRCm39) E281G possibly damaging Het
Klra3 G C 6: 130,310,107 (GRCm39) R138G probably benign Het
Lgr6 T A 1: 135,032,670 (GRCm39) Y70F possibly damaging Het
Lnx1 T G 5: 74,780,678 (GRCm39) D330A probably damaging Het
Lrp5 T C 19: 3,664,234 (GRCm39) N106S probably benign Het
Mamdc4 C A 2: 25,459,759 (GRCm39) R135L possibly damaging Het
Mcm3ap A G 10: 76,340,121 (GRCm39) E1464G probably damaging Het
Megf8 T C 7: 25,034,280 (GRCm39) V666A possibly damaging Het
Mettl3 T A 14: 52,534,385 (GRCm39) E331D probably benign Het
Mphosph9 T C 5: 124,405,204 (GRCm39) K789R probably damaging Het
Mtf2 T C 5: 108,239,995 (GRCm39) L234P probably damaging Het
Ncdn C A 4: 126,642,491 (GRCm39) E389* probably null Het
Ndor1 A G 2: 25,139,279 (GRCm39) S231P probably damaging Het
Nelfa T G 5: 34,056,215 (GRCm39) K483Q probably damaging Het
Odad1 T A 7: 45,592,282 (GRCm39) M354K probably benign Het
Opn1sw C T 6: 29,378,923 (GRCm39) R243Q probably benign Het
Or13a24 T A 7: 140,155,034 (GRCm39) probably null Het
Or9e1 A G 11: 58,732,792 (GRCm39) N284S probably damaging Het
Pik3cd T C 4: 149,739,653 (GRCm39) E584G probably damaging Het
Plcb3 A T 19: 6,935,041 (GRCm39) M870K possibly damaging Het
Poc5 A G 13: 96,528,152 (GRCm39) D16G probably damaging Het
Prpf40a A G 2: 53,035,852 (GRCm39) I633T probably damaging Het
Ptpn13 G T 5: 103,704,044 (GRCm39) E1359* probably null Het
Ptprr C A 10: 116,024,113 (GRCm39) Y4* probably null Het
Rbm45 T C 2: 76,202,503 (GRCm39) probably null Het
Rfng C T 11: 120,672,687 (GRCm39) W320* probably null Het
Rgs6 G T 12: 83,138,547 (GRCm39) V294L probably benign Het
Rufy4 T C 1: 74,169,002 (GRCm39) probably null Het
Ruvbl2 T A 7: 45,073,566 (GRCm39) N313I probably damaging Het
Sema4g G A 19: 44,981,256 (GRCm39) V70M probably damaging Het
Siglec1 T C 2: 130,918,078 (GRCm39) T969A probably benign Het
Slc22a27 T A 19: 7,844,348 (GRCm39) T431S possibly damaging Het
Slc25a16 G A 10: 62,756,643 (GRCm39) R38H probably damaging Het
Slc38a6 T C 12: 73,391,626 (GRCm39) V296A probably benign Het
Slc39a11 C T 11: 113,196,748 (GRCm39) V212I probably damaging Het
Sltm A G 9: 70,493,948 (GRCm39) K782E probably damaging Het
Styxl1 T A 5: 135,799,175 (GRCm39) Y23F probably damaging Het
Svs4 T C 2: 164,120,148 (GRCm39) I20V unknown Het
Syt14 G T 1: 192,613,084 (GRCm39) T572K possibly damaging Het
Tbc1d5 A T 17: 51,227,603 (GRCm39) I214N possibly damaging Het
Tm9sf3 A G 19: 41,227,223 (GRCm39) S283P probably benign Het
Tmtc1 C T 6: 148,147,208 (GRCm39) probably null Het
Ttn T A 2: 76,602,802 (GRCm39) K18473N probably damaging Het
Ubr2 A C 17: 47,278,173 (GRCm39) Y721* probably null Het
Vmn1r14 T A 6: 57,211,286 (GRCm39) I288N probably damaging Het
Vmn2r103 T C 17: 19,993,662 (GRCm39) I13T probably benign Het
Vps13a A T 19: 16,678,494 (GRCm39) Y1162* probably null Het
Vps51 C A 19: 6,121,497 (GRCm39) R175L probably benign Het
Zfp523 C A 17: 28,423,473 (GRCm39) S149R probably benign Het
Zik1 A G 7: 10,224,053 (GRCm39) I348T possibly damaging Het
Znfx1 T A 2: 166,898,708 (GRCm39) H72L probably benign Het
Other mutations in Ttll7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ttll7 APN 3 146,615,337 (GRCm39) missense possibly damaging 0.72
IGL01353:Ttll7 APN 3 146,667,474 (GRCm39) missense probably damaging 1.00
IGL01415:Ttll7 APN 3 146,615,354 (GRCm39) missense possibly damaging 0.90
IGL01843:Ttll7 APN 3 146,645,776 (GRCm39) missense possibly damaging 0.93
IGL03101:Ttll7 APN 3 146,602,445 (GRCm39) missense possibly damaging 0.82
IGL03378:Ttll7 APN 3 146,615,408 (GRCm39) missense probably benign 0.06
P0038:Ttll7 UTSW 3 146,650,939 (GRCm39) missense possibly damaging 0.80
R0265:Ttll7 UTSW 3 146,649,915 (GRCm39) nonsense probably null
R0358:Ttll7 UTSW 3 146,649,871 (GRCm39) missense probably benign
R0363:Ttll7 UTSW 3 146,649,970 (GRCm39) missense probably benign 0.00
R0364:Ttll7 UTSW 3 146,650,936 (GRCm39) missense possibly damaging 0.82
R0751:Ttll7 UTSW 3 146,645,746 (GRCm39) missense probably damaging 1.00
R1184:Ttll7 UTSW 3 146,645,746 (GRCm39) missense probably damaging 1.00
R1771:Ttll7 UTSW 3 146,600,160 (GRCm39) missense probably benign 0.02
R1789:Ttll7 UTSW 3 146,621,535 (GRCm39) missense probably damaging 1.00
R1961:Ttll7 UTSW 3 146,621,550 (GRCm39) splice site probably benign
R1995:Ttll7 UTSW 3 146,667,510 (GRCm39) missense possibly damaging 0.95
R2083:Ttll7 UTSW 3 146,635,859 (GRCm39) missense possibly damaging 0.77
R2152:Ttll7 UTSW 3 146,635,944 (GRCm39) missense probably damaging 1.00
R2655:Ttll7 UTSW 3 146,653,376 (GRCm39) missense probably damaging 1.00
R2926:Ttll7 UTSW 3 146,636,170 (GRCm39) nonsense probably null
R4888:Ttll7 UTSW 3 146,599,932 (GRCm39) start codon destroyed probably null 0.99
R4999:Ttll7 UTSW 3 146,600,224 (GRCm39) missense probably damaging 1.00
R5648:Ttll7 UTSW 3 146,667,465 (GRCm39) missense probably damaging 1.00
R5937:Ttll7 UTSW 3 146,649,847 (GRCm39) nonsense probably null
R6009:Ttll7 UTSW 3 146,640,290 (GRCm39) missense probably damaging 0.99
R6036:Ttll7 UTSW 3 146,645,917 (GRCm39) missense probably benign
R6036:Ttll7 UTSW 3 146,645,917 (GRCm39) missense probably benign
R6463:Ttll7 UTSW 3 146,637,337 (GRCm39) missense possibly damaging 0.86
R6747:Ttll7 UTSW 3 146,649,811 (GRCm39) missense probably benign 0.02
R6922:Ttll7 UTSW 3 146,615,369 (GRCm39) missense possibly damaging 0.92
R7123:Ttll7 UTSW 3 146,619,051 (GRCm39) missense possibly damaging 0.95
R7211:Ttll7 UTSW 3 146,619,031 (GRCm39) missense probably damaging 0.97
R8229:Ttll7 UTSW 3 146,607,204 (GRCm39) missense probably damaging 0.99
R8406:Ttll7 UTSW 3 146,645,779 (GRCm39) missense probably benign
R9343:Ttll7 UTSW 3 146,667,497 (GRCm39) missense probably damaging 1.00
R9348:Ttll7 UTSW 3 146,673,768 (GRCm39) missense probably benign 0.31
R9629:Ttll7 UTSW 3 146,621,487 (GRCm39) missense probably damaging 1.00
RF015:Ttll7 UTSW 3 146,685,413 (GRCm39) missense probably benign 0.00
X0024:Ttll7 UTSW 3 146,615,308 (GRCm39) missense probably damaging 1.00
X0026:Ttll7 UTSW 3 146,667,450 (GRCm39) missense probably damaging 1.00
X0027:Ttll7 UTSW 3 146,653,408 (GRCm39) missense probably damaging 1.00
Z1176:Ttll7 UTSW 3 146,653,390 (GRCm39) missense probably damaging 1.00
Z1176:Ttll7 UTSW 3 146,635,933 (GRCm39) missense probably benign 0.01
Z1176:Ttll7 UTSW 3 146,621,526 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTATAAGGAGTGGGGCCAGTC -3'
(R):5'- TGCAAAGAGTCAGCACAGCCAG -3'

Sequencing Primer
(F):5'- AGTCTGCACCTGGAACACTG -3'
(R):5'- AGCCAGCGAGCAACGAG -3'
Posted On 2014-04-13