Incidental Mutation 'R1533:Lnx1'
ID166733
Institutional Source Beutler Lab
Gene Symbol Lnx1
Ensembl Gene ENSMUSG00000029228
Gene Nameligand of numb-protein X 1
Synonyms
MMRRC Submission 039572-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R1533 (G1)
Quality Score111
Status Not validated
Chromosome5
Chromosomal Location74592447-74702912 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 74620017 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 330 (D330A)
Ref Sequence ENSEMBL: ENSMUSP00000113565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039744] [ENSMUST00000087161] [ENSMUST00000113531] [ENSMUST00000117388] [ENSMUST00000117525] [ENSMUST00000121690] [ENSMUST00000127396] [ENSMUST00000153543]
Predicted Effect probably damaging
Transcript: ENSMUST00000039744
AA Change: D340A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040098
Gene: ENSMUSG00000029228
AA Change: D340A

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Blast:PDZ 57 164 1e-33 BLAST
PDZ 188 263 5.33e-19 SMART
PDZ 295 368 2.27e-13 SMART
PDZ 417 494 8.27e-16 SMART
PDZ 547 624 5.71e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000087161
AA Change: D440A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084405
Gene: ENSMUSG00000029228
AA Change: D440A

DomainStartEndE-ValueType
RING 45 82 5.82e-6 SMART
low complexity region 97 107 N/A INTRINSIC
Blast:PDZ 157 264 3e-33 BLAST
PDZ 288 363 5.33e-19 SMART
PDZ 395 468 2.27e-13 SMART
PDZ 517 594 8.27e-16 SMART
PDZ 647 724 5.71e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113531
AA Change: D281A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109159
Gene: ENSMUSG00000029228
AA Change: D281A

DomainStartEndE-ValueType
Blast:PDZ 2 105 2e-32 BLAST
PDZ 129 204 5.33e-19 SMART
PDZ 236 309 2.27e-13 SMART
PDZ 358 435 8.27e-16 SMART
PDZ 488 565 5.71e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117388
AA Change: D440A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113035
Gene: ENSMUSG00000029228
AA Change: D440A

DomainStartEndE-ValueType
RING 45 82 5.82e-6 SMART
low complexity region 97 107 N/A INTRINSIC
Blast:PDZ 157 264 3e-33 BLAST
PDZ 288 363 5.33e-19 SMART
PDZ 395 468 2.27e-13 SMART
PDZ 517 594 8.27e-16 SMART
PDZ 647 724 5.71e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117525
AA Change: D340A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113837
Gene: ENSMUSG00000029228
AA Change: D340A

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Blast:PDZ 57 164 1e-33 BLAST
PDZ 188 263 5.33e-19 SMART
PDZ 295 368 2.27e-13 SMART
PDZ 417 494 8.27e-16 SMART
PDZ 547 624 5.71e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121690
AA Change: D330A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113565
Gene: ENSMUSG00000029228
AA Change: D330A

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
PDZ 178 253 5.33e-19 SMART
PDZ 285 358 2.27e-13 SMART
PDZ 407 484 8.27e-16 SMART
PDZ 537 614 5.71e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127396
SMART Domains Protein: ENSMUSP00000120886
Gene: ENSMUSG00000029228

DomainStartEndE-ValueType
low complexity region 4 12 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000140084
AA Change: D123A
SMART Domains Protein: ENSMUSP00000117935
Gene: ENSMUSG00000029228
AA Change: D123A

DomainStartEndE-ValueType
PDZ 1 47 2.73e-1 SMART
PDZ 79 154 1.51e-9 SMART
PDZ 156 233 8.27e-16 SMART
SCOP:d1qaua_ 274 322 3e-7 SMART
Blast:PDZ 286 322 4e-19 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000153543
AA Change: D281A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121094
Gene: ENSMUSG00000029228
AA Change: D281A

DomainStartEndE-ValueType
Blast:PDZ 2 105 9e-37 BLAST
Blast:PDZ 129 159 1e-12 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound protein that is involved in signal transduction and protein interactions. The encoded product is an E3 ubiquitin-protein ligase, which mediates ubiquitination and subsequent proteasomal degradation of proteins containing phosphotyrosine binding (PTB) domains. This protein may play an important role in tumorogenesis. Alternatively spliced transcript variants encoding distinct isoforms have been described. A pseudogene, which is located on chromosome 17, has been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit an increased percentage of B1-like B cells in peritoneal lavage when compared with that of controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 37,041,375 G4509V probably damaging Het
Abca4 G C 3: 122,135,158 G1340A probably benign Het
Ambra1 T A 2: 91,886,865 Y836N probably damaging Het
Arhgap26 A T 18: 39,371,077 H144L probably benign Het
B3gnt5 A G 16: 19,769,614 I194M probably damaging Het
Bod1l A T 5: 41,822,155 C605* probably null Het
C2cd3 G T 7: 100,406,077 K482N possibly damaging Het
Ccdc114 T A 7: 45,942,858 M354K probably benign Het
Cd300lg T A 11: 102,043,221 L98Q probably damaging Het
Cerkl T A 2: 79,341,357 I386F possibly damaging Het
Cfh T A 1: 140,100,978 D466V possibly damaging Het
Crtc1 A T 8: 70,398,299 I221N probably damaging Het
Ctnnbl1 T C 2: 157,836,643 S389P probably benign Het
Ctsb A T 14: 63,139,095 D258V probably damaging Het
Cuzd1 G T 7: 131,311,703 T395N probably damaging Het
Dnah6 T C 6: 73,151,553 T1240A probably benign Het
Dok7 T A 5: 35,064,327 probably null Het
Dscaml1 T C 9: 45,450,584 V214A probably damaging Het
Enpp6 A T 8: 47,065,434 Y199F probably benign Het
Entpd5 C A 12: 84,394,660 K111N probably damaging Het
Fam98a A G 17: 75,541,281 L146S probably damaging Het
Fhod3 A T 18: 25,115,864 I1367F probably damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fpr3 T A 17: 17,970,660 Y64* probably null Het
Fzd6 A T 15: 39,031,624 H395L probably damaging Het
Gcsh T A 8: 116,989,182 H54L probably damaging Het
Gsdma T A 11: 98,676,384 S437T unknown Het
Gzmc A G 14: 56,233,919 V55A probably damaging Het
Hecw2 T A 1: 53,926,545 probably null Het
Ifi207 A G 1: 173,727,740 V792A probably benign Het
Itpr3 C A 17: 27,095,560 N661K possibly damaging Het
Jmy A T 13: 93,441,311 I783N probably benign Het
Kcmf1 T C 6: 72,843,020 E281G possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lgr6 T A 1: 135,104,932 Y70F possibly damaging Het
Lrp5 T C 19: 3,614,234 N106S probably benign Het
Mamdc4 C A 2: 25,569,747 R135L possibly damaging Het
Mcm3ap A G 10: 76,504,287 E1464G probably damaging Het
Megf8 T C 7: 25,334,855 V666A possibly damaging Het
Mettl3 T A 14: 52,296,928 E331D probably benign Het
Mphosph9 T C 5: 124,267,141 K789R probably damaging Het
Mtf2 T C 5: 108,092,129 L234P probably damaging Het
Ncdn C A 4: 126,748,698 E389* probably null Het
Ndor1 A G 2: 25,249,267 S231P probably damaging Het
Nelfa T G 5: 33,898,871 K483Q probably damaging Het
Olfr311 A G 11: 58,841,966 N284S probably damaging Het
Olfr538 T A 7: 140,575,121 probably null Het
Opn1sw C T 6: 29,378,924 R243Q probably benign Het
Pik3cd T C 4: 149,655,196 E584G probably damaging Het
Plcb3 A T 19: 6,957,673 M870K possibly damaging Het
Poc5 A G 13: 96,391,644 D16G probably damaging Het
Prpf40a A G 2: 53,145,840 I633T probably damaging Het
Ptpn13 G T 5: 103,556,178 E1359* probably null Het
Ptprr C A 10: 116,188,208 Y4* probably null Het
Rbm45 T C 2: 76,372,159 probably null Het
Rfng C T 11: 120,781,861 W320* probably null Het
Rgs6 G T 12: 83,091,773 V294L probably benign Het
Rufy4 T C 1: 74,129,843 probably null Het
Ruvbl2 T A 7: 45,424,142 N313I probably damaging Het
Sema4g G A 19: 44,992,817 V70M probably damaging Het
Siglec1 T C 2: 131,076,158 T969A probably benign Het
Slc22a27 T A 19: 7,866,983 T431S possibly damaging Het
Slc25a16 G A 10: 62,920,864 R38H probably damaging Het
Slc38a6 T C 12: 73,344,852 V296A probably benign Het
Slc39a11 C T 11: 113,305,922 V212I probably damaging Het
Sltm A G 9: 70,586,666 K782E probably damaging Het
Styxl1 T A 5: 135,770,321 Y23F probably damaging Het
Svs4 T C 2: 164,278,228 I20V unknown Het
Syt14 G T 1: 192,930,776 T572K possibly damaging Het
Tbc1d5 A T 17: 50,920,575 I214N possibly damaging Het
Tm9sf3 A G 19: 41,238,784 S283P probably benign Het
Tmtc1 C T 6: 148,245,710 probably null Het
Ttll7 T A 3: 146,896,667 N73K probably damaging Het
Ttn T A 2: 76,772,458 K18473N probably damaging Het
Ubr2 A C 17: 46,967,247 Y721* probably null Het
Vmn1r14 T A 6: 57,234,301 I288N probably damaging Het
Vmn2r103 T C 17: 19,773,400 I13T probably benign Het
Vps13a A T 19: 16,701,130 Y1162* probably null Het
Vps51 C A 19: 6,071,467 R175L probably benign Het
Zfp523 C A 17: 28,204,499 S149R probably benign Het
Zik1 A G 7: 10,490,126 I348T possibly damaging Het
Znfx1 T A 2: 167,056,788 H72L probably benign Het
Other mutations in Lnx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Lnx1 APN 5 74685717 missense probably benign 0.00
IGL01538:Lnx1 APN 5 74620155 missense possibly damaging 0.50
IGL02351:Lnx1 APN 5 74627366 missense probably damaging 0.97
IGL02358:Lnx1 APN 5 74627366 missense probably damaging 0.97
IGL03011:Lnx1 APN 5 74685759 missense probably benign 0.02
IGL03188:Lnx1 APN 5 74620263 missense probably damaging 1.00
R0490:Lnx1 UTSW 5 74620347 critical splice acceptor site probably null
R0714:Lnx1 UTSW 5 74607909 splice site probably benign
R1343:Lnx1 UTSW 5 74597379 missense probably damaging 0.98
R1681:Lnx1 UTSW 5 74685410 missense probably benign
R1714:Lnx1 UTSW 5 74607737 missense probably null 1.00
R1727:Lnx1 UTSW 5 74607916 splice site probably null
R1806:Lnx1 UTSW 5 74606049 missense probably damaging 1.00
R2091:Lnx1 UTSW 5 74620066 missense probably benign 0.25
R2879:Lnx1 UTSW 5 74620123 missense probably benign 0.03
R2984:Lnx1 UTSW 5 74685422 nonsense probably null
R3790:Lnx1 UTSW 5 74628366 splice site probably benign
R3953:Lnx1 UTSW 5 74606089 missense probably benign
R4509:Lnx1 UTSW 5 74620192 missense probably damaging 1.00
R4510:Lnx1 UTSW 5 74620192 missense probably damaging 1.00
R4511:Lnx1 UTSW 5 74620192 missense probably damaging 1.00
R4575:Lnx1 UTSW 5 74685543 missense probably damaging 1.00
R4583:Lnx1 UTSW 5 74610796 missense probably benign 0.16
R4624:Lnx1 UTSW 5 74660460 intron probably benign
R4647:Lnx1 UTSW 5 74610796 missense probably benign 0.16
R4648:Lnx1 UTSW 5 74610796 missense probably benign 0.16
R4877:Lnx1 UTSW 5 74628123 missense probably benign 0.01
R4883:Lnx1 UTSW 5 74607869 missense probably benign
R5256:Lnx1 UTSW 5 74685654 missense probably damaging 1.00
R6169:Lnx1 UTSW 5 74677569 missense probably damaging 1.00
R6185:Lnx1 UTSW 5 74685608 nonsense probably null
R6408:Lnx1 UTSW 5 74685646 missense probably damaging 1.00
R6476:Lnx1 UTSW 5 74607880 missense possibly damaging 0.52
R7083:Lnx1 UTSW 5 74628185 missense possibly damaging 0.94
R7085:Lnx1 UTSW 5 74628185 missense possibly damaging 0.94
R7261:Lnx1 UTSW 5 74677514 nonsense probably null
R7511:Lnx1 UTSW 5 74620311 missense probably benign 0.01
R7574:Lnx1 UTSW 5 74685438 missense probably benign 0.33
R7670:Lnx1 UTSW 5 74685690 missense probably damaging 1.00
Z1177:Lnx1 UTSW 5 74627441 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ATTGAAAACGCCAGCCCTTGCC -3'
(R):5'- AGAAGTTCCGTAGCAGAAGCAATGC -3'

Sequencing Primer
(F):5'- CCTGACCTCCTTAGAGGGAAG -3'
(R):5'- TCCTATGGACCTCGGGATGAC -3'
Posted On2014-04-13