Incidental Mutation 'R1533:Opn1sw'
ID166739
Institutional Source Beutler Lab
Gene Symbol Opn1sw
Ensembl Gene ENSMUSG00000058831
Gene Nameopsin 1 (cone pigments), short-wave-sensitive (color blindness, tritan)
SynonymsBlue/UV Opsin, Bcp, UV cone pigment, Blue Opsin, SWS opsin, Short Wavelength Sensitive opsin, S Opsin, Blue Cone Opsin
MMRRC Submission 039572-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1533 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location29376671-29388468 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29378924 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 243 (R243Q)
Ref Sequence ENSEMBL: ENSMUSP00000079289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031779] [ENSMUST00000080428] [ENSMUST00000090481] [ENSMUST00000147483] [ENSMUST00000172974] [ENSMUST00000173216] [ENSMUST00000173653] [ENSMUST00000173694] [ENSMUST00000174096]
Predicted Effect probably benign
Transcript: ENSMUST00000031779
SMART Domains Protein: ENSMUSP00000031779
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EFh 72 100 1.1e1 SMART
Blast:EFh 108 136 3e-11 BLAST
EFh 155 183 9.61e1 SMART
EFh 192 220 2.03e-2 SMART
Blast:EFh 233 261 2e-10 BLAST
EFh 269 297 5.75e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080428
AA Change: R243Q

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000079289
Gene: ENSMUSG00000058831
AA Change: R243Q

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 41 318 4e-9 PFAM
Pfam:7tm_1 49 301 2.5e-43 PFAM
Pfam:7tm_4 188 319 6.2e-8 PFAM
low complexity region 330 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090481
SMART Domains Protein: ENSMUSP00000087967
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EFh 72 100 1.82e0 SMART
EFh 108 136 2.44e1 SMART
EFh 155 183 9.61e1 SMART
EFh 192 220 2.03e-2 SMART
Blast:EFh 233 261 2e-10 BLAST
EFh 269 297 5.75e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138523
Predicted Effect probably benign
Transcript: ENSMUST00000147483
AA Change: R243Q

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133745
Gene: ENSMUSG00000058831
AA Change: R243Q

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 40 250 9.2e-7 PFAM
Pfam:7TM_GPCR_Srv 41 254 1.8e-6 PFAM
Pfam:7tm_1 49 271 1.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172607
SMART Domains Protein: ENSMUSP00000133609
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
Blast:EFh 2 20 1e-5 BLAST
SCOP:d2mysb_ 2 51 6e-5 SMART
Blast:EFh 28 56 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172974
SMART Domains Protein: ENSMUSP00000133390
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EFh 72 100 1.1e1 SMART
Blast:EFh 108 136 1e-11 BLAST
EFh 155 183 9.61e1 SMART
EFh 192 220 1.41e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173216
SMART Domains Protein: ENSMUSP00000134708
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
EFh 3 31 9.61e1 SMART
EFh 40 68 2.03e-2 SMART
Blast:EFh 81 109 2e-11 BLAST
EFh 117 145 5.75e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173653
SMART Domains Protein: ENSMUSP00000133534
Gene: ENSMUSG00000058831

DomainStartEndE-ValueType
Pfam:7tm_1 1 61 6.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173694
SMART Domains Protein: ENSMUSP00000133436
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EFh 72 100 5.38e0 SMART
EFh 108 136 5.75e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174096
SMART Domains Protein: ENSMUSP00000133945
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EF-hand_7 43 97 5.3e-8 PFAM
Pfam:EF-hand_6 72 101 6.5e-5 PFAM
Pfam:EF-hand_7 72 133 5e-12 PFAM
Pfam:EF-hand_5 73 98 4.5e-5 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the G-protein coupled receptor 1 family, opsin subfamily. It encodes the blue cone pigment gene which is one of three types of cone photoreceptors responsible for normal color vision. Defects in this gene are the cause of tritan color blindness (tritanopia). Affected individuals lack blue and yellow sensory mechanisms while retaining those for red and green. Defective blue vision is characteristic. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal cone physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 37,041,375 G4509V probably damaging Het
Abca4 G C 3: 122,135,158 G1340A probably benign Het
Ambra1 T A 2: 91,886,865 Y836N probably damaging Het
Arhgap26 A T 18: 39,371,077 H144L probably benign Het
B3gnt5 A G 16: 19,769,614 I194M probably damaging Het
Bod1l A T 5: 41,822,155 C605* probably null Het
C2cd3 G T 7: 100,406,077 K482N possibly damaging Het
Ccdc114 T A 7: 45,942,858 M354K probably benign Het
Cd300lg T A 11: 102,043,221 L98Q probably damaging Het
Cerkl T A 2: 79,341,357 I386F possibly damaging Het
Cfh T A 1: 140,100,978 D466V possibly damaging Het
Crtc1 A T 8: 70,398,299 I221N probably damaging Het
Ctnnbl1 T C 2: 157,836,643 S389P probably benign Het
Ctsb A T 14: 63,139,095 D258V probably damaging Het
Cuzd1 G T 7: 131,311,703 T395N probably damaging Het
Dnah6 T C 6: 73,151,553 T1240A probably benign Het
Dok7 T A 5: 35,064,327 probably null Het
Dscaml1 T C 9: 45,450,584 V214A probably damaging Het
Enpp6 A T 8: 47,065,434 Y199F probably benign Het
Entpd5 C A 12: 84,394,660 K111N probably damaging Het
Fam98a A G 17: 75,541,281 L146S probably damaging Het
Fhod3 A T 18: 25,115,864 I1367F probably damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fpr3 T A 17: 17,970,660 Y64* probably null Het
Fzd6 A T 15: 39,031,624 H395L probably damaging Het
Gcsh T A 8: 116,989,182 H54L probably damaging Het
Gsdma T A 11: 98,676,384 S437T unknown Het
Gzmc A G 14: 56,233,919 V55A probably damaging Het
Hecw2 T A 1: 53,926,545 probably null Het
Ifi207 A G 1: 173,727,740 V792A probably benign Het
Itpr3 C A 17: 27,095,560 N661K possibly damaging Het
Jmy A T 13: 93,441,311 I783N probably benign Het
Kcmf1 T C 6: 72,843,020 E281G possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lgr6 T A 1: 135,104,932 Y70F possibly damaging Het
Lnx1 T G 5: 74,620,017 D330A probably damaging Het
Lrp5 T C 19: 3,614,234 N106S probably benign Het
Mamdc4 C A 2: 25,569,747 R135L possibly damaging Het
Mcm3ap A G 10: 76,504,287 E1464G probably damaging Het
Megf8 T C 7: 25,334,855 V666A possibly damaging Het
Mettl3 T A 14: 52,296,928 E331D probably benign Het
Mphosph9 T C 5: 124,267,141 K789R probably damaging Het
Mtf2 T C 5: 108,092,129 L234P probably damaging Het
Ncdn C A 4: 126,748,698 E389* probably null Het
Ndor1 A G 2: 25,249,267 S231P probably damaging Het
Nelfa T G 5: 33,898,871 K483Q probably damaging Het
Olfr311 A G 11: 58,841,966 N284S probably damaging Het
Olfr538 T A 7: 140,575,121 probably null Het
Pik3cd T C 4: 149,655,196 E584G probably damaging Het
Plcb3 A T 19: 6,957,673 M870K possibly damaging Het
Poc5 A G 13: 96,391,644 D16G probably damaging Het
Prpf40a A G 2: 53,145,840 I633T probably damaging Het
Ptpn13 G T 5: 103,556,178 E1359* probably null Het
Ptprr C A 10: 116,188,208 Y4* probably null Het
Rbm45 T C 2: 76,372,159 probably null Het
Rfng C T 11: 120,781,861 W320* probably null Het
Rgs6 G T 12: 83,091,773 V294L probably benign Het
Rufy4 T C 1: 74,129,843 probably null Het
Ruvbl2 T A 7: 45,424,142 N313I probably damaging Het
Sema4g G A 19: 44,992,817 V70M probably damaging Het
Siglec1 T C 2: 131,076,158 T969A probably benign Het
Slc22a27 T A 19: 7,866,983 T431S possibly damaging Het
Slc25a16 G A 10: 62,920,864 R38H probably damaging Het
Slc38a6 T C 12: 73,344,852 V296A probably benign Het
Slc39a11 C T 11: 113,305,922 V212I probably damaging Het
Sltm A G 9: 70,586,666 K782E probably damaging Het
Styxl1 T A 5: 135,770,321 Y23F probably damaging Het
Svs4 T C 2: 164,278,228 I20V unknown Het
Syt14 G T 1: 192,930,776 T572K possibly damaging Het
Tbc1d5 A T 17: 50,920,575 I214N possibly damaging Het
Tm9sf3 A G 19: 41,238,784 S283P probably benign Het
Tmtc1 C T 6: 148,245,710 probably null Het
Ttll7 T A 3: 146,896,667 N73K probably damaging Het
Ttn T A 2: 76,772,458 K18473N probably damaging Het
Ubr2 A C 17: 46,967,247 Y721* probably null Het
Vmn1r14 T A 6: 57,234,301 I288N probably damaging Het
Vmn2r103 T C 17: 19,773,400 I13T probably benign Het
Vps13a A T 19: 16,701,130 Y1162* probably null Het
Vps51 C A 19: 6,071,467 R175L probably benign Het
Zfp523 C A 17: 28,204,499 S149R probably benign Het
Zik1 A G 7: 10,490,126 I348T possibly damaging Het
Znfx1 T A 2: 167,056,788 H72L probably benign Het
Other mutations in Opn1sw
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03157:Opn1sw APN 6 29379804 missense possibly damaging 0.88
R0550:Opn1sw UTSW 6 29380204 missense probably damaging 1.00
R1902:Opn1sw UTSW 6 29379804 missense possibly damaging 0.88
R4085:Opn1sw UTSW 6 29380144 missense possibly damaging 0.89
R4418:Opn1sw UTSW 6 29379424 nonsense probably null
R4812:Opn1sw UTSW 6 29378039 missense probably damaging 0.99
R5692:Opn1sw UTSW 6 29379841 unclassified probably benign
R5839:Opn1sw UTSW 6 29379830 missense probably damaging 1.00
R5915:Opn1sw UTSW 6 29379755 unclassified probably null
R6045:Opn1sw UTSW 6 29379870 missense probably damaging 1.00
R6295:Opn1sw UTSW 6 29379414 missense possibly damaging 0.90
R6784:Opn1sw UTSW 6 29379847 missense probably damaging 1.00
R7259:Opn1sw UTSW 6 29378912 missense probably benign
R7315:Opn1sw UTSW 6 29379363 missense probably damaging 1.00
R7412:Opn1sw UTSW 6 29379857 missense probably damaging 1.00
R7749:Opn1sw UTSW 6 29380169 missense probably benign 0.00
Z1176:Opn1sw UTSW 6 29379456 missense probably damaging 1.00
Z1177:Opn1sw UTSW 6 29380344 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTCATGTGCCTACCAAGAGCATCC -3'
(R):5'- TGAGGACTCTCAGAGCTGTGAGTG -3'

Sequencing Primer
(F):5'- GTCTAATGGACCAGAACCTCGTG -3'
(R):5'- gcaggtgtgaggtactggg -3'
Posted On2014-04-13