Incidental Mutation 'R1533:Tmtc1'
ID166745
Institutional Source Beutler Lab
Gene Symbol Tmtc1
Ensembl Gene ENSMUSG00000030306
Gene Nametransmembrane and tetratricopeptide repeat containing 1
Synonyms
MMRRC Submission 039572-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R1533 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location148232430-148444389 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 148245710 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000098335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060095] [ENSMUST00000100772] [ENSMUST00000140797]
Predicted Effect probably null
Transcript: ENSMUST00000060095
SMART Domains Protein: ENSMUSP00000056353
Gene: ENSMUSG00000030306

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
transmembrane domain 111 130 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
low complexity region 170 180 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
low complexity region 250 269 N/A INTRINSIC
transmembrane domain 328 350 N/A INTRINSIC
Pfam:DUF1736 351 425 1.3e-33 PFAM
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 494 516 N/A INTRINSIC
TPR 543 576 2.42e-3 SMART
TPR 577 607 8.76e-1 SMART
TPR 608 641 1.69e-2 SMART
TPR 642 675 1.28e-2 SMART
TPR 676 709 4.31e0 SMART
TPR 710 743 1.11e-2 SMART
TPR 744 776 4.62e0 SMART
TPR 811 844 1.1e-1 SMART
TPR 849 882 4.45e-2 SMART
TPR 883 916 1.05e-3 SMART
low complexity region 926 941 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100772
SMART Domains Protein: ENSMUSP00000098335
Gene: ENSMUSG00000030306

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
transmembrane domain 111 130 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
low complexity region 170 180 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
low complexity region 250 269 N/A INTRINSIC
Pfam:DUF1736 349 427 6.9e-35 PFAM
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 494 516 N/A INTRINSIC
TPR 539 569 8.76e-1 SMART
TPR 570 603 1.69e-2 SMART
TPR 604 637 1.28e-2 SMART
TPR 638 671 4.31e0 SMART
TPR 672 705 1.11e-2 SMART
TPR 706 738 4.62e0 SMART
TPR 773 806 1.1e-1 SMART
TPR 811 844 4.45e-2 SMART
TPR 845 878 1.05e-3 SMART
low complexity region 888 903 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140797
SMART Domains Protein: ENSMUSP00000115543
Gene: ENSMUSG00000030306

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
transmembrane domain 112 134 N/A INTRINSIC
low complexity region 160 179 N/A INTRINSIC
Pfam:DUF1736 259 337 9.9e-36 PFAM
transmembrane domain 357 379 N/A INTRINSIC
transmembrane domain 403 425 N/A INTRINSIC
Pfam:TPR_12 449 516 9.6e-10 PFAM
Pfam:TPR_11 451 498 1.3e-9 PFAM
Pfam:TPR_1 453 486 5.7e-6 PFAM
Pfam:TPR_2 453 486 2.6e-7 PFAM
Pfam:TPR_8 453 486 6.5e-4 PFAM
Pfam:TPR_1 487 517 1.6e-3 PFAM
Pfam:TPR_8 496 518 1.5e-3 PFAM
low complexity region 521 539 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 37,041,375 G4509V probably damaging Het
Abca4 G C 3: 122,135,158 G1340A probably benign Het
Ambra1 T A 2: 91,886,865 Y836N probably damaging Het
Arhgap26 A T 18: 39,371,077 H144L probably benign Het
B3gnt5 A G 16: 19,769,614 I194M probably damaging Het
Bod1l A T 5: 41,822,155 C605* probably null Het
C2cd3 G T 7: 100,406,077 K482N possibly damaging Het
Ccdc114 T A 7: 45,942,858 M354K probably benign Het
Cd300lg T A 11: 102,043,221 L98Q probably damaging Het
Cerkl T A 2: 79,341,357 I386F possibly damaging Het
Cfh T A 1: 140,100,978 D466V possibly damaging Het
Crtc1 A T 8: 70,398,299 I221N probably damaging Het
Ctnnbl1 T C 2: 157,836,643 S389P probably benign Het
Ctsb A T 14: 63,139,095 D258V probably damaging Het
Cuzd1 G T 7: 131,311,703 T395N probably damaging Het
Dnah6 T C 6: 73,151,553 T1240A probably benign Het
Dok7 T A 5: 35,064,327 probably null Het
Dscaml1 T C 9: 45,450,584 V214A probably damaging Het
Enpp6 A T 8: 47,065,434 Y199F probably benign Het
Entpd5 C A 12: 84,394,660 K111N probably damaging Het
Fam98a A G 17: 75,541,281 L146S probably damaging Het
Fhod3 A T 18: 25,115,864 I1367F probably damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fpr3 T A 17: 17,970,660 Y64* probably null Het
Fzd6 A T 15: 39,031,624 H395L probably damaging Het
Gcsh T A 8: 116,989,182 H54L probably damaging Het
Gsdma T A 11: 98,676,384 S437T unknown Het
Gzmc A G 14: 56,233,919 V55A probably damaging Het
Hecw2 T A 1: 53,926,545 probably null Het
Ifi207 A G 1: 173,727,740 V792A probably benign Het
Itpr3 C A 17: 27,095,560 N661K possibly damaging Het
Jmy A T 13: 93,441,311 I783N probably benign Het
Kcmf1 T C 6: 72,843,020 E281G possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lgr6 T A 1: 135,104,932 Y70F possibly damaging Het
Lnx1 T G 5: 74,620,017 D330A probably damaging Het
Lrp5 T C 19: 3,614,234 N106S probably benign Het
Mamdc4 C A 2: 25,569,747 R135L possibly damaging Het
Mcm3ap A G 10: 76,504,287 E1464G probably damaging Het
Megf8 T C 7: 25,334,855 V666A possibly damaging Het
Mettl3 T A 14: 52,296,928 E331D probably benign Het
Mphosph9 T C 5: 124,267,141 K789R probably damaging Het
Mtf2 T C 5: 108,092,129 L234P probably damaging Het
Ncdn C A 4: 126,748,698 E389* probably null Het
Ndor1 A G 2: 25,249,267 S231P probably damaging Het
Nelfa T G 5: 33,898,871 K483Q probably damaging Het
Olfr311 A G 11: 58,841,966 N284S probably damaging Het
Olfr538 T A 7: 140,575,121 probably null Het
Opn1sw C T 6: 29,378,924 R243Q probably benign Het
Pik3cd T C 4: 149,655,196 E584G probably damaging Het
Plcb3 A T 19: 6,957,673 M870K possibly damaging Het
Poc5 A G 13: 96,391,644 D16G probably damaging Het
Prpf40a A G 2: 53,145,840 I633T probably damaging Het
Ptpn13 G T 5: 103,556,178 E1359* probably null Het
Ptprr C A 10: 116,188,208 Y4* probably null Het
Rbm45 T C 2: 76,372,159 probably null Het
Rfng C T 11: 120,781,861 W320* probably null Het
Rgs6 G T 12: 83,091,773 V294L probably benign Het
Rufy4 T C 1: 74,129,843 probably null Het
Ruvbl2 T A 7: 45,424,142 N313I probably damaging Het
Sema4g G A 19: 44,992,817 V70M probably damaging Het
Siglec1 T C 2: 131,076,158 T969A probably benign Het
Slc22a27 T A 19: 7,866,983 T431S possibly damaging Het
Slc25a16 G A 10: 62,920,864 R38H probably damaging Het
Slc38a6 T C 12: 73,344,852 V296A probably benign Het
Slc39a11 C T 11: 113,305,922 V212I probably damaging Het
Sltm A G 9: 70,586,666 K782E probably damaging Het
Styxl1 T A 5: 135,770,321 Y23F probably damaging Het
Svs4 T C 2: 164,278,228 I20V unknown Het
Syt14 G T 1: 192,930,776 T572K possibly damaging Het
Tbc1d5 A T 17: 50,920,575 I214N possibly damaging Het
Tm9sf3 A G 19: 41,238,784 S283P probably benign Het
Ttll7 T A 3: 146,896,667 N73K probably damaging Het
Ttn T A 2: 76,772,458 K18473N probably damaging Het
Ubr2 A C 17: 46,967,247 Y721* probably null Het
Vmn1r14 T A 6: 57,234,301 I288N probably damaging Het
Vmn2r103 T C 17: 19,773,400 I13T probably benign Het
Vps13a A T 19: 16,701,130 Y1162* probably null Het
Vps51 C A 19: 6,071,467 R175L probably benign Het
Zfp523 C A 17: 28,204,499 S149R probably benign Het
Zik1 A G 7: 10,490,126 I348T possibly damaging Het
Znfx1 T A 2: 167,056,788 H72L probably benign Het
Other mutations in Tmtc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Tmtc1 APN 6 148443944 missense probably benign 0.02
IGL01377:Tmtc1 APN 6 148245787 missense possibly damaging 0.82
IGL01728:Tmtc1 APN 6 148411066 missense probably benign 0.02
IGL02904:Tmtc1 APN 6 148249482 splice site probably benign
R0044:Tmtc1 UTSW 6 148412829 splice site probably benign
R0107:Tmtc1 UTSW 6 148425913 missense possibly damaging 0.85
R0114:Tmtc1 UTSW 6 148412830 splice site probably benign
R0243:Tmtc1 UTSW 6 148246837 missense probably damaging 1.00
R0310:Tmtc1 UTSW 6 148249581 missense probably benign 0.00
R0441:Tmtc1 UTSW 6 148415758 missense probably damaging 1.00
R0491:Tmtc1 UTSW 6 148412640 critical splice donor site probably null
R0578:Tmtc1 UTSW 6 148355218 intron probably benign
R0685:Tmtc1 UTSW 6 148411240 missense probably benign 0.39
R1470:Tmtc1 UTSW 6 148305985 splice site probably benign
R1577:Tmtc1 UTSW 6 148412820 critical splice acceptor site probably null
R1617:Tmtc1 UTSW 6 148355404 intron probably benign
R1763:Tmtc1 UTSW 6 148294618 missense probably damaging 1.00
R1909:Tmtc1 UTSW 6 148444048 missense possibly damaging 0.93
R1943:Tmtc1 UTSW 6 148425918 nonsense probably null
R2050:Tmtc1 UTSW 6 148262883 missense probably damaging 1.00
R2305:Tmtc1 UTSW 6 148244697 missense probably damaging 0.99
R3813:Tmtc1 UTSW 6 148354891 intron probably benign
R4355:Tmtc1 UTSW 6 148355098 intron probably benign
R4537:Tmtc1 UTSW 6 148262782 critical splice donor site probably null
R4731:Tmtc1 UTSW 6 148284980 splice site probably null
R4732:Tmtc1 UTSW 6 148284980 splice site probably null
R4733:Tmtc1 UTSW 6 148284980 splice site probably null
R4960:Tmtc1 UTSW 6 148443947 unclassified probably benign
R5048:Tmtc1 UTSW 6 148237846 missense possibly damaging 0.96
R5118:Tmtc1 UTSW 6 148269987 intron probably benign
R5279:Tmtc1 UTSW 6 148355131 intron probably benign
R5310:Tmtc1 UTSW 6 148355412 intron probably benign
R5411:Tmtc1 UTSW 6 148443899 critical splice donor site probably null
R5646:Tmtc1 UTSW 6 148246831 missense probably damaging 1.00
R5868:Tmtc1 UTSW 6 148237855 missense probably damaging 1.00
R6482:Tmtc1 UTSW 6 148412745 missense probably benign 0.00
R7162:Tmtc1 UTSW 6 148271487 missense probably damaging 1.00
R7462:Tmtc1 UTSW 6 148325145 missense probably damaging 1.00
R7702:Tmtc1 UTSW 6 148443917 missense probably benign 0.35
RF018:Tmtc1 UTSW 6 148247511 missense probably damaging 1.00
Z1177:Tmtc1 UTSW 6 148411080 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CATTAGAACTTGGAGAGCCAGCGG -3'
(R):5'- AGGTGTCTTCTAAGCTCAGTGCCC -3'

Sequencing Primer
(F):5'- TGTCTGAGAAAAGCTCCCG -3'
(R):5'- CTCTTGTTTTGCAGGCACAG -3'
Posted On2014-04-13