Incidental Mutation 'R1533:Entpd5'
ID166771
Institutional Source Beutler Lab
Gene Symbol Entpd5
Ensembl Gene ENSMUSG00000021236
Gene Nameectonucleoside triphosphate diphosphohydrolase 5
SynonymsER-UDPase, Cd39l4, NTPDase-5, Pcph, NTPDase5, mNTPase
MMRRC Submission 039572-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1533 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location84373857-84409029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 84394660 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 111 (K111N)
Ref Sequence ENSEMBL: ENSMUSP00000071939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021662] [ENSMUST00000072061] [ENSMUST00000110272] [ENSMUST00000117286] [ENSMUST00000120942] [ENSMUST00000122194]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021662
AA Change: K86N

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021662
Gene: ENSMUSG00000021236
AA Change: K86N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072061
AA Change: K111N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071939
Gene: ENSMUSG00000021236
AA Change: K111N

DomainStartEndE-ValueType
transmembrane domain 27 46 N/A INTRINSIC
Pfam:GDA1_CD39 65 451 1.9e-77 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110272
AA Change: K86N

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105901
Gene: ENSMUSG00000021236
AA Change: K86N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117286
AA Change: K86N

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114011
Gene: ENSMUSG00000021236
AA Change: K86N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120942
AA Change: K86N

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112516
Gene: ENSMUSG00000021236
AA Change: K86N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122194
AA Change: K86N

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113106
Gene: ENSMUSG00000021236
AA Change: K86N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GDA1_CD39 41 426 3.5e-76 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to E-type nucleotidases (NTPases)/ecto-ATPase/apyrases. NTPases, such as CD39, mediate catabolism of extracellular nucleotides. ENTPD5 contains 4 apyrase-conserved regions which is characteristic of NTPases. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a null allele develop progressive hepatopathy, hepatocellular tumors, and spermatogenic arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 37,041,375 G4509V probably damaging Het
Abca4 G C 3: 122,135,158 G1340A probably benign Het
Ambra1 T A 2: 91,886,865 Y836N probably damaging Het
Arhgap26 A T 18: 39,371,077 H144L probably benign Het
B3gnt5 A G 16: 19,769,614 I194M probably damaging Het
Bod1l A T 5: 41,822,155 C605* probably null Het
C2cd3 G T 7: 100,406,077 K482N possibly damaging Het
Ccdc114 T A 7: 45,942,858 M354K probably benign Het
Cd300lg T A 11: 102,043,221 L98Q probably damaging Het
Cerkl T A 2: 79,341,357 I386F possibly damaging Het
Cfh T A 1: 140,100,978 D466V possibly damaging Het
Crtc1 A T 8: 70,398,299 I221N probably damaging Het
Ctnnbl1 T C 2: 157,836,643 S389P probably benign Het
Ctsb A T 14: 63,139,095 D258V probably damaging Het
Cuzd1 G T 7: 131,311,703 T395N probably damaging Het
Dnah6 T C 6: 73,151,553 T1240A probably benign Het
Dok7 T A 5: 35,064,327 probably null Het
Dscaml1 T C 9: 45,450,584 V214A probably damaging Het
Enpp6 A T 8: 47,065,434 Y199F probably benign Het
Fam98a A G 17: 75,541,281 L146S probably damaging Het
Fhod3 A T 18: 25,115,864 I1367F probably damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fpr3 T A 17: 17,970,660 Y64* probably null Het
Fzd6 A T 15: 39,031,624 H395L probably damaging Het
Gcsh T A 8: 116,989,182 H54L probably damaging Het
Gsdma T A 11: 98,676,384 S437T unknown Het
Gzmc A G 14: 56,233,919 V55A probably damaging Het
Hecw2 T A 1: 53,926,545 probably null Het
Ifi207 A G 1: 173,727,740 V792A probably benign Het
Itpr3 C A 17: 27,095,560 N661K possibly damaging Het
Jmy A T 13: 93,441,311 I783N probably benign Het
Kcmf1 T C 6: 72,843,020 E281G possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lgr6 T A 1: 135,104,932 Y70F possibly damaging Het
Lnx1 T G 5: 74,620,017 D330A probably damaging Het
Lrp5 T C 19: 3,614,234 N106S probably benign Het
Mamdc4 C A 2: 25,569,747 R135L possibly damaging Het
Mcm3ap A G 10: 76,504,287 E1464G probably damaging Het
Megf8 T C 7: 25,334,855 V666A possibly damaging Het
Mettl3 T A 14: 52,296,928 E331D probably benign Het
Mphosph9 T C 5: 124,267,141 K789R probably damaging Het
Mtf2 T C 5: 108,092,129 L234P probably damaging Het
Ncdn C A 4: 126,748,698 E389* probably null Het
Ndor1 A G 2: 25,249,267 S231P probably damaging Het
Nelfa T G 5: 33,898,871 K483Q probably damaging Het
Olfr311 A G 11: 58,841,966 N284S probably damaging Het
Olfr538 T A 7: 140,575,121 probably null Het
Opn1sw C T 6: 29,378,924 R243Q probably benign Het
Pik3cd T C 4: 149,655,196 E584G probably damaging Het
Plcb3 A T 19: 6,957,673 M870K possibly damaging Het
Poc5 A G 13: 96,391,644 D16G probably damaging Het
Prpf40a A G 2: 53,145,840 I633T probably damaging Het
Ptpn13 G T 5: 103,556,178 E1359* probably null Het
Ptprr C A 10: 116,188,208 Y4* probably null Het
Rbm45 T C 2: 76,372,159 probably null Het
Rfng C T 11: 120,781,861 W320* probably null Het
Rgs6 G T 12: 83,091,773 V294L probably benign Het
Rufy4 T C 1: 74,129,843 probably null Het
Ruvbl2 T A 7: 45,424,142 N313I probably damaging Het
Sema4g G A 19: 44,992,817 V70M probably damaging Het
Siglec1 T C 2: 131,076,158 T969A probably benign Het
Slc22a27 T A 19: 7,866,983 T431S possibly damaging Het
Slc25a16 G A 10: 62,920,864 R38H probably damaging Het
Slc38a6 T C 12: 73,344,852 V296A probably benign Het
Slc39a11 C T 11: 113,305,922 V212I probably damaging Het
Sltm A G 9: 70,586,666 K782E probably damaging Het
Styxl1 T A 5: 135,770,321 Y23F probably damaging Het
Svs4 T C 2: 164,278,228 I20V unknown Het
Syt14 G T 1: 192,930,776 T572K possibly damaging Het
Tbc1d5 A T 17: 50,920,575 I214N possibly damaging Het
Tm9sf3 A G 19: 41,238,784 S283P probably benign Het
Tmtc1 C T 6: 148,245,710 probably null Het
Ttll7 T A 3: 146,896,667 N73K probably damaging Het
Ttn T A 2: 76,772,458 K18473N probably damaging Het
Ubr2 A C 17: 46,967,247 Y721* probably null Het
Vmn1r14 T A 6: 57,234,301 I288N probably damaging Het
Vmn2r103 T C 17: 19,773,400 I13T probably benign Het
Vps13a A T 19: 16,701,130 Y1162* probably null Het
Vps51 C A 19: 6,071,467 R175L probably benign Het
Zfp523 C A 17: 28,204,499 S149R probably benign Het
Zik1 A G 7: 10,490,126 I348T possibly damaging Het
Znfx1 T A 2: 167,056,788 H72L probably benign Het
Other mutations in Entpd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Entpd5 APN 12 84387054 missense probably damaging 1.00
IGL01455:Entpd5 APN 12 84394677 missense probably benign 0.00
IGL02168:Entpd5 APN 12 84386978 critical splice donor site probably null
IGL02183:Entpd5 APN 12 84380380 splice site probably benign
IGL03104:Entpd5 APN 12 84384248 missense probably damaging 0.97
IGL03332:Entpd5 APN 12 84382228 splice site probably null
aventi UTSW 12 84382295 nonsense probably null
eatsy UTSW 12 84382295 nonsense probably null
magenschonend UTSW 12 84394690 missense probably benign 0.00
R0024:Entpd5 UTSW 12 84373733 missense probably benign 0.01
R0103:Entpd5 UTSW 12 84396943 nonsense probably null
R0103:Entpd5 UTSW 12 84396943 nonsense probably null
R0644:Entpd5 UTSW 12 84386141 missense probably benign 0.00
R1536:Entpd5 UTSW 12 84382295 nonsense probably null
R1740:Entpd5 UTSW 12 84396771 missense probably benign 0.01
R1768:Entpd5 UTSW 12 84386211 missense probably benign
R2049:Entpd5 UTSW 12 84396858 missense probably benign 0.00
R5128:Entpd5 UTSW 12 84394690 missense probably benign 0.00
R6562:Entpd5 UTSW 12 84386200 missense probably damaging 1.00
R6907:Entpd5 UTSW 12 84377353 missense probably benign 0.23
R7209:Entpd5 UTSW 12 84396928 missense probably benign
R7605:Entpd5 UTSW 12 84396708 missense probably damaging 1.00
X0057:Entpd5 UTSW 12 84384220 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCCTGAACACCAGGAGATGTTTAACGA -3'
(R):5'- ATCTGAAGCAGTCTACCCTCTGACAA -3'

Sequencing Primer
(F):5'- agaaccctaaacatcaaattaagcc -3'
(R):5'- tcctctttttcttcttcttcttcttc -3'
Posted On2014-04-13