Incidental Mutation 'R1533:Vps51'
ID 166792
Institutional Source Beutler Lab
Gene Symbol Vps51
Ensembl Gene ENSMUSG00000024797
Gene Name VPS51 GARP complex subunit
Synonyms
MMRRC Submission 039572-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1533 (G1)
Quality Score 188
Status Not validated
Chromosome 19
Chromosomal Location 6067842-6080324 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 6071467 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 175 (R175L)
Ref Sequence ENSEMBL: ENSMUSP00000123994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025711] [ENSMUST00000025713] [ENSMUST00000113543] [ENSMUST00000159084] [ENSMUST00000159832] [ENSMUST00000160028] [ENSMUST00000160233] [ENSMUST00000161090] [ENSMUST00000161528] [ENSMUST00000162810] [ENSMUST00000160590] [ENSMUST00000161718] [ENSMUST00000162575]
AlphaFold Q3UVL4
Predicted Effect probably benign
Transcript: ENSMUST00000025711
AA Change: R175L

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000025711
Gene: ENSMUSG00000024799
AA Change: R175L

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:COG2 56 191 2.6e-10 PFAM
Pfam:DUF2450 62 250 2.3e-14 PFAM
Pfam:Vps51 63 149 1.1e-26 PFAM
Pfam:Dor1 75 246 1.8e-19 PFAM
Pfam:Zw10 83 291 2.2e-8 PFAM
Pfam:Sec5 101 275 6.5e-24 PFAM
low complexity region 377 391 N/A INTRINSIC
low complexity region 523 532 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025713
SMART Domains Protein: ENSMUSP00000025713
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 418 1.6e-141 PFAM
Pfam:DUF1295 250 409 9.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113543
SMART Domains Protein: ENSMUSP00000109171
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 373 9.9e-112 PFAM
Pfam:DUF1295 249 396 2.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159084
SMART Domains Protein: ENSMUSP00000124868
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 300 6.4e-75 PFAM
Pfam:ERG4_ERG24 292 391 2.2e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159211
Predicted Effect probably benign
Transcript: ENSMUST00000159475
Predicted Effect probably benign
Transcript: ENSMUST00000159832
AA Change: R175L

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000123994
Gene: ENSMUSG00000024797
AA Change: R175L

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:COG2 56 191 2e-10 PFAM
Pfam:DUF2450 62 250 1.9e-14 PFAM
Pfam:Vps51 63 149 8.3e-27 PFAM
Pfam:Dor1 75 246 1.8e-19 PFAM
Pfam:Sec5 101 275 1.6e-19 PFAM
low complexity region 276 292 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
low complexity region 523 532 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159869
Predicted Effect probably benign
Transcript: ENSMUST00000160028
SMART Domains Protein: ENSMUSP00000124847
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160233
SMART Domains Protein: ENSMUSP00000124842
Gene: ENSMUSG00000024797

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160519
Predicted Effect probably benign
Transcript: ENSMUST00000161090
SMART Domains Protein: ENSMUSP00000125543
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161528
SMART Domains Protein: ENSMUSP00000123989
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 109 5.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162810
SMART Domains Protein: ENSMUSP00000124825
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 9 124 6.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160590
SMART Domains Protein: ENSMUSP00000123857
Gene: ENSMUSG00000024797

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Vps51 63 121 2.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161718
SMART Domains Protein: ENSMUSP00000124283
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 1 197 5.7e-86 PFAM
Pfam:DUF1295 46 185 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162575
SMART Domains Protein: ENSMUSP00000125586
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:ERG4_ERG24 51 229 5.5e-59 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated protein 51 family. The encoded protein is a component of the Golgi-associated retrograde protein complex which acts as a tethering factor for carriers in retrograde transport from the early and late endosomes to the trans-Golgi network. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 37,041,375 G4509V probably damaging Het
Abca4 G C 3: 122,135,158 G1340A probably benign Het
Ambra1 T A 2: 91,886,865 Y836N probably damaging Het
Arhgap26 A T 18: 39,371,077 H144L probably benign Het
B3gnt5 A G 16: 19,769,614 I194M probably damaging Het
Bod1l A T 5: 41,822,155 C605* probably null Het
C2cd3 G T 7: 100,406,077 K482N possibly damaging Het
Ccdc114 T A 7: 45,942,858 M354K probably benign Het
Cd300lg T A 11: 102,043,221 L98Q probably damaging Het
Cerkl T A 2: 79,341,357 I386F possibly damaging Het
Cfh T A 1: 140,100,978 D466V possibly damaging Het
Crtc1 A T 8: 70,398,299 I221N probably damaging Het
Ctnnbl1 T C 2: 157,836,643 S389P probably benign Het
Ctsb A T 14: 63,139,095 D258V probably damaging Het
Cuzd1 G T 7: 131,311,703 T395N probably damaging Het
Dnah6 T C 6: 73,151,553 T1240A probably benign Het
Dok7 T A 5: 35,064,327 probably null Het
Dscaml1 T C 9: 45,450,584 V214A probably damaging Het
Enpp6 A T 8: 47,065,434 Y199F probably benign Het
Entpd5 C A 12: 84,394,660 K111N probably damaging Het
Fam98a A G 17: 75,541,281 L146S probably damaging Het
Fhod3 A T 18: 25,115,864 I1367F probably damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Fpr3 T A 17: 17,970,660 Y64* probably null Het
Fzd6 A T 15: 39,031,624 H395L probably damaging Het
Gcsh T A 8: 116,989,182 H54L probably damaging Het
Gsdma T A 11: 98,676,384 S437T unknown Het
Gzmc A G 14: 56,233,919 V55A probably damaging Het
Hecw2 T A 1: 53,926,545 probably null Het
Ifi207 A G 1: 173,727,740 V792A probably benign Het
Itpr3 C A 17: 27,095,560 N661K possibly damaging Het
Jmy A T 13: 93,441,311 I783N probably benign Het
Kcmf1 T C 6: 72,843,020 E281G possibly damaging Het
Klra3 G C 6: 130,333,144 R138G probably benign Het
Lgr6 T A 1: 135,104,932 Y70F possibly damaging Het
Lnx1 T G 5: 74,620,017 D330A probably damaging Het
Lrp5 T C 19: 3,614,234 N106S probably benign Het
Mamdc4 C A 2: 25,569,747 R135L possibly damaging Het
Mcm3ap A G 10: 76,504,287 E1464G probably damaging Het
Megf8 T C 7: 25,334,855 V666A possibly damaging Het
Mettl3 T A 14: 52,296,928 E331D probably benign Het
Mphosph9 T C 5: 124,267,141 K789R probably damaging Het
Mtf2 T C 5: 108,092,129 L234P probably damaging Het
Ncdn C A 4: 126,748,698 E389* probably null Het
Ndor1 A G 2: 25,249,267 S231P probably damaging Het
Nelfa T G 5: 33,898,871 K483Q probably damaging Het
Olfr311 A G 11: 58,841,966 N284S probably damaging Het
Olfr538 T A 7: 140,575,121 probably null Het
Opn1sw C T 6: 29,378,924 R243Q probably benign Het
Pik3cd T C 4: 149,655,196 E584G probably damaging Het
Plcb3 A T 19: 6,957,673 M870K possibly damaging Het
Poc5 A G 13: 96,391,644 D16G probably damaging Het
Prpf40a A G 2: 53,145,840 I633T probably damaging Het
Ptpn13 G T 5: 103,556,178 E1359* probably null Het
Ptprr C A 10: 116,188,208 Y4* probably null Het
Rbm45 T C 2: 76,372,159 probably null Het
Rfng C T 11: 120,781,861 W320* probably null Het
Rgs6 G T 12: 83,091,773 V294L probably benign Het
Rufy4 T C 1: 74,129,843 probably null Het
Ruvbl2 T A 7: 45,424,142 N313I probably damaging Het
Sema4g G A 19: 44,992,817 V70M probably damaging Het
Siglec1 T C 2: 131,076,158 T969A probably benign Het
Slc22a27 T A 19: 7,866,983 T431S possibly damaging Het
Slc25a16 G A 10: 62,920,864 R38H probably damaging Het
Slc38a6 T C 12: 73,344,852 V296A probably benign Het
Slc39a11 C T 11: 113,305,922 V212I probably damaging Het
Sltm A G 9: 70,586,666 K782E probably damaging Het
Styxl1 T A 5: 135,770,321 Y23F probably damaging Het
Svs4 T C 2: 164,278,228 I20V unknown Het
Syt14 G T 1: 192,930,776 T572K possibly damaging Het
Tbc1d5 A T 17: 50,920,575 I214N possibly damaging Het
Tm9sf3 A G 19: 41,238,784 S283P probably benign Het
Tmtc1 C T 6: 148,245,710 probably null Het
Ttll7 T A 3: 146,896,667 N73K probably damaging Het
Ttn T A 2: 76,772,458 K18473N probably damaging Het
Ubr2 A C 17: 46,967,247 Y721* probably null Het
Vmn1r14 T A 6: 57,234,301 I288N probably damaging Het
Vmn2r103 T C 17: 19,773,400 I13T probably benign Het
Vps13a A T 19: 16,701,130 Y1162* probably null Het
Zfp523 C A 17: 28,204,499 S149R probably benign Het
Zik1 A G 7: 10,490,126 I348T possibly damaging Het
Znfx1 T A 2: 167,056,788 H72L probably benign Het
Other mutations in Vps51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03095:Vps51 APN 19 6070048 missense probably damaging 1.00
R0238:Vps51 UTSW 19 6071437 nonsense probably null
R0238:Vps51 UTSW 19 6071437 nonsense probably null
R0239:Vps51 UTSW 19 6071437 nonsense probably null
R0239:Vps51 UTSW 19 6071437 nonsense probably null
R1909:Vps51 UTSW 19 6069469 missense probably benign 0.03
R2022:Vps51 UTSW 19 6071582 missense probably benign 0.02
R2146:Vps51 UTSW 19 6068134 missense probably benign 0.25
R2148:Vps51 UTSW 19 6068134 missense probably benign 0.25
R2149:Vps51 UTSW 19 6068134 missense probably benign 0.25
R2901:Vps51 UTSW 19 6076438 missense probably damaging 0.99
R3717:Vps51 UTSW 19 6077168 utr 3 prime probably benign
R3769:Vps51 UTSW 19 6076348 missense possibly damaging 0.54
R5192:Vps51 UTSW 19 6070467 missense possibly damaging 0.88
R5210:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5256:Vps51 UTSW 19 6070488 missense probably benign 0.00
R5260:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5261:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5274:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5294:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5295:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5389:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5391:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5392:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5393:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5421:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5422:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5497:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5498:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5499:Vps51 UTSW 19 6071033 missense probably benign 0.00
R5671:Vps51 UTSW 19 6068194 missense probably benign 0.18
R5963:Vps51 UTSW 19 6068290 missense probably damaging 1.00
R5989:Vps51 UTSW 19 6076372 missense probably damaging 0.96
R6427:Vps51 UTSW 19 6070917 missense possibly damaging 0.77
R7247:Vps51 UTSW 19 6077389 utr 3 prime probably benign
R9344:Vps51 UTSW 19 6076315 missense unknown
Predicted Primers PCR Primer
(F):5'- TTTGGAGAACAATGACCAGGCCC -3'
(R):5'- GCTCAACTCTTGCCCATCTAGACAC -3'

Sequencing Primer
(F):5'- TGACCAGGCCCGGAAAC -3'
(R):5'- TTCGAAAGATGAAGAATGACTTCCG -3'
Posted On 2014-04-13