Mutagenetix > Incidental Mutation

Incidental Mutation 'R1534:Celsr3'

166832

Institutional Source

Beutler Lab

Gene Symbol

Celsr3

Ensembl Gene

ENSMUSG00000023473

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 3

Synonyms

Fmi1, flamingo, Adgrc3

MMRRC Submission

039573-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1534 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108703519-108730168 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108726083 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 3104 (E3104G)

Ref Sequence

ENSEMBL: ENSMUSP00000150759 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024238] [ENSMUST00000192507] [ENSMUST00000194079] [ENSMUST00000213524]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000024238
AA Change: E3096G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000024238
Gene: ENSMUSG00000023473
AA Change: E3096G

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
low complexity region	264	293	N/A	INTRINSIC
CA	338	422	2.25e-27	SMART
CA	446	534	5.05e-30	SMART
CA	558	640	7.6e-25	SMART
CA	664	745	7.36e-32	SMART
CA	769	847	5.95e-18	SMART
CA	871	950	5.25e-28	SMART
CA	974	1056	2.67e-29	SMART
CA	1080	1158	1.18e-21	SMART
CA	1186	1262	3.2e-1	SMART
low complexity region	1328	1335	N/A	INTRINSIC
low complexity region	1350	1360	N/A	INTRINSIC
EGF	1369	1424	1.02e-2	SMART
EGF	1429	1464	3.23e0	SMART
EGF	1467	1503	8.78e-2	SMART
LamG	1524	1691	2.27e-35	SMART
EGF	1714	1747	4.22e-4	SMART
LamG	1774	1913	9.02e-21	SMART
EGF	1938	1971	2.43e-4	SMART
EGF	1973	2009	1.3e-4	SMART
EGF_Lam	2066	2111	5.08e-7	SMART
HormR	2114	2176	3.42e-21	SMART
Pfam:GAIN	2188	2441	1.1e-57	PFAM
GPS	2467	2520	7.92e-20	SMART
Pfam:7tm_2	2527	2758	1.5e-56	PFAM
low complexity region	2813	2829	N/A	INTRINSIC
low complexity region	2882	2906	N/A	INTRINSIC
low complexity region	3058	3072	N/A	INTRINSIC
low complexity region	3149	3189	N/A	INTRINSIC
low complexity region	3239	3261	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175326

Predicted Effect

probably benign
Transcript: ENSMUST00000192507

SMART Domains

Protein: ENSMUSP00000141336
Gene: ENSMUSG00000023259

Domain	Start	End	E-Value	Type
Pfam:Sulfate_tra_GLY	54	137	4.1e-33	PFAM
Pfam:Sulfate_transp	176	454	1.9e-67	PFAM
low complexity region	471	484	N/A	INTRINSIC
PDB:3LLO\|A	489	546	6e-16	PDB
low complexity region	554	593	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193825

Predicted Effect

probably benign
Transcript: ENSMUST00000194079

SMART Domains

Protein: ENSMUSP00000141789
Gene: ENSMUSG00000023473

Domain	Start	End	E-Value	Type
Pfam:7tm_2	1	185	6.9e-45	PFAM
low complexity region	240	256	N/A	INTRINSIC
low complexity region	309	333	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195857

Predicted Effect

probably damaging
Transcript: ENSMUST00000213524
AA Change: E3104G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

Meta Mutation Damage Score

0.0636

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 94.0%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the flamingo subfamily, which is included in the cadherin superfamily. The flamingo cadherins consist of nonclassic-type cadherins that do not interact with catenins. They are plasma membrane proteins containing seven epidermal growth factor-like repeats, nine cadherin domains and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic feature of their subfamily. The encoded protein may be involved in the regulation of contact-dependent neurite growth and may play a role in tumor formation. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, abnormal neurvous system development, and abnormal respiratory system development. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy10	T	C	1: 165,345,881 (GRCm39)	I310T	probably damaging	Het
Adcy5	T	C	16: 35,073,629 (GRCm39)	V469A	possibly damaging	Het
Agrn	C	T	4: 156,261,141 (GRCm39)	C652Y	probably damaging	Het
Ankfn1	C	T	11: 89,413,977 (GRCm39)	V133M	probably damaging	Het
Ankrd13c	A	G	3: 157,706,757 (GRCm39)	T448A	probably benign	Het
Atp8b1	C	T	18: 64,678,335 (GRCm39)	V854M	probably damaging	Het
B4galt2	T	C	4: 117,734,669 (GRCm39)	H233R	probably damaging	Het
Bpifb5	T	G	2: 154,071,419 (GRCm39)	Y249D	possibly damaging	Het
Brd1	T	C	15: 88,573,866 (GRCm39)	I1078V	possibly damaging	Het
Cyp2c69	T	A	19: 39,839,593 (GRCm39)	K343N	probably benign	Het
Cyp4f18	T	A	8: 72,746,799 (GRCm39)	D331V	probably damaging	Het
D130040H23Rik	T	C	8: 69,755,378 (GRCm39)	V261A	possibly damaging	Het
Dchs1	T	C	7: 105,421,247 (GRCm39)	D391G	probably damaging	Het
Diaph1	A	G	18: 38,029,146 (GRCm39)		probably null	Het
Fat4	T	C	3: 38,944,238 (GRCm39)	F1044L	probably damaging	Het
Frrs1	A	T	3: 116,672,057 (GRCm39)	T52S	probably benign	Het
Gan	G	A	8: 117,914,168 (GRCm39)	V189I	probably benign	Het
Hnf1b	A	G	11: 83,784,409 (GRCm39)		probably benign	Het
Itgae	T	C	11: 73,036,431 (GRCm39)	I1123T	possibly damaging	Het
Klra3	G	C	6: 130,310,107 (GRCm39)	R138G	probably benign	Het
Lrrc18	A	G	14: 32,730,478 (GRCm39)	K6E	possibly damaging	Het
Map2	G	A	1: 66,452,339 (GRCm39)	V492I	probably benign	Het
Mtr	A	T	13: 12,250,430 (GRCm39)		probably benign	Het
Ncor1	G	T	11: 62,269,330 (GRCm39)	A689E	possibly damaging	Het
Or52n2c	G	A	7: 104,574,621 (GRCm39)	L117F	possibly damaging	Het
Or5w22	T	A	2: 87,363,016 (GRCm39)	V213D	probably damaging	Het
Palm	T	G	10: 79,652,737 (GRCm39)	V42G	probably damaging	Het
Pcm1	G	A	8: 41,740,738 (GRCm39)	V995I	probably benign	Het
Pfkp	A	G	13: 6,669,574 (GRCm39)	V215A	probably damaging	Het
Prkg2	T	C	5: 99,142,420 (GRCm39)	Y238C	probably damaging	Het
Prr14	C	T	7: 127,073,154 (GRCm39)	A167V	probably benign	Het
Ptprn	A	C	1: 75,234,587 (GRCm39)		probably null	Het
Rexo2	A	T	9: 48,380,190 (GRCm39)	I214N	probably damaging	Het
Rrbp1	A	G	2: 143,830,233 (GRCm39)	S645P	probably damaging	Het
Rsf1	G	GACGGCGGCA	7: 97,229,116 (GRCm39)		probably benign	Het
Satb2	A	T	1: 56,987,392 (GRCm39)	C64*	probably null	Het
Sez6	A	G	11: 77,853,871 (GRCm39)	Y347C	probably damaging	Het
Sos2	A	G	12: 69,663,729 (GRCm39)	I585T	probably damaging	Het
Spg11	G	A	2: 121,922,806 (GRCm39)	T881M	probably damaging	Het
Tiam1	A	T	16: 89,664,396 (GRCm39)		probably null	Het
Tlcd5	A	G	9: 43,022,923 (GRCm39)	W126R	probably damaging	Het
Top1	T	C	2: 160,556,152 (GRCm39)	I537T	probably damaging	Het
Trappc6a	A	G	7: 19,248,138 (GRCm39)	S33G	probably benign	Het
Tspan11	G	C	6: 127,926,768 (GRCm39)	V239L	probably benign	Het
Ubr4	T	C	4: 139,155,462 (GRCm39)	V2190A	possibly damaging	Het
Usp28	A	G	9: 48,896,806 (GRCm39)	D9G	possibly damaging	Het
Uty	A	G	Y: 1,245,440 (GRCm39)	V35A	probably benign	Het
Vmn2r56	A	G	7: 12,427,954 (GRCm39)	S771P	probably benign	Het
Wars2	C	T	3: 99,124,177 (GRCm39)	A346V	probably damaging	Het
Wdr87-ps	G	T	7: 29,229,854 (GRCm39)		noncoding transcript	Het
Zfp142	G	T	1: 74,611,247 (GRCm39)	N849K	probably benign	Het
Zfp180	A	T	7: 23,800,948 (GRCm39)	N66I	probably benign	Het

Other mutations in Celsr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Celsr3	APN	9	108,726,124 (GRCm39)	missense	probably damaging	1.00
IGL00536:Celsr3	APN	9	108,706,391 (GRCm39)	missense	probably benign	0.33
IGL00552:Celsr3	APN	9	108,718,462 (GRCm39)	missense	possibly damaging	0.88
IGL00801:Celsr3	APN	9	108,719,775 (GRCm39)	missense	probably benign
IGL01420:Celsr3	APN	9	108,718,389 (GRCm39)	critical splice acceptor site	probably null
IGL01541:Celsr3	APN	9	108,708,907 (GRCm39)	missense	probably damaging	1.00
IGL01619:Celsr3	APN	9	108,711,756 (GRCm39)	missense	probably damaging	1.00
IGL01619:Celsr3	APN	9	108,714,603 (GRCm39)	missense	probably benign	0.00
IGL01631:Celsr3	APN	9	108,714,603 (GRCm39)	missense	probably benign	0.00
IGL01777:Celsr3	APN	9	108,713,141 (GRCm39)	missense	probably benign	0.08
IGL01938:Celsr3	APN	9	108,705,614 (GRCm39)	missense	probably benign	0.34
IGL02135:Celsr3	APN	9	108,704,755 (GRCm39)	missense	probably benign	0.11
IGL02231:Celsr3	APN	9	108,719,709 (GRCm39)	missense	probably damaging	1.00
IGL02234:Celsr3	APN	9	108,707,159 (GRCm39)	missense	probably benign
IGL02392:Celsr3	APN	9	108,711,920 (GRCm39)	splice site	probably benign
IGL02416:Celsr3	APN	9	108,709,318 (GRCm39)	missense	probably damaging	1.00
IGL02421:Celsr3	APN	9	108,717,662 (GRCm39)	missense	probably damaging	1.00
IGL02455:Celsr3	APN	9	108,720,092 (GRCm39)	missense	probably benign	0.15
IGL02798:Celsr3	APN	9	108,720,774 (GRCm39)	missense	probably damaging	1.00
IGL02939:Celsr3	APN	9	108,726,652 (GRCm39)	missense	probably damaging	1.00
IGL02947:Celsr3	APN	9	108,723,134 (GRCm39)	missense	probably benign	0.12
IGL02986:Celsr3	APN	9	108,718,454 (GRCm39)	splice site	probably null
IGL03089:Celsr3	APN	9	108,703,806 (GRCm39)	missense	probably benign	0.04
IGL03162:Celsr3	APN	9	108,719,757 (GRCm39)	missense	probably damaging	1.00
IGL03267:Celsr3	APN	9	108,713,724 (GRCm39)	splice site	probably benign
Diminishment	UTSW	9	108,719,907 (GRCm39)	intron	probably benign
little_d	UTSW	9	108,704,891 (GRCm39)	missense	probably damaging	0.98
nogal	UTSW	9	108,713,037 (GRCm39)	missense	probably benign
F6893:Celsr3	UTSW	9	108,712,266 (GRCm39)	missense	probably benign	0.00
PIT4243001:Celsr3	UTSW	9	108,709,507 (GRCm39)	missense	probably benign	0.13
PIT4810001:Celsr3	UTSW	9	108,722,932 (GRCm39)	missense	probably damaging	1.00
R0110:Celsr3	UTSW	9	108,704,204 (GRCm39)	missense	possibly damaging	0.62
R0243:Celsr3	UTSW	9	108,720,923 (GRCm39)	splice site	probably benign
R0382:Celsr3	UTSW	9	108,706,417 (GRCm39)	missense	probably damaging	1.00
R0482:Celsr3	UTSW	9	108,706,272 (GRCm39)	nonsense	probably null
R0510:Celsr3	UTSW	9	108,704,204 (GRCm39)	missense	possibly damaging	0.62
R0630:Celsr3	UTSW	9	108,704,891 (GRCm39)	missense	probably damaging	0.98
R0656:Celsr3	UTSW	9	108,711,854 (GRCm39)	missense	possibly damaging	0.89
R0764:Celsr3	UTSW	9	108,705,017 (GRCm39)	missense	probably damaging	1.00
R0883:Celsr3	UTSW	9	108,719,832 (GRCm39)	missense	probably damaging	1.00
R0924:Celsr3	UTSW	9	108,723,224 (GRCm39)	missense	possibly damaging	0.78
R1015:Celsr3	UTSW	9	108,710,375 (GRCm39)	missense	probably benign	0.17
R1321:Celsr3	UTSW	9	108,713,069 (GRCm39)	missense	probably damaging	1.00
R1423:Celsr3	UTSW	9	108,704,104 (GRCm39)	missense	probably benign	0.00
R1497:Celsr3	UTSW	9	108,726,064 (GRCm39)	missense	probably benign	0.14
R1520:Celsr3	UTSW	9	108,725,857 (GRCm39)	missense	probably damaging	1.00
R1569:Celsr3	UTSW	9	108,706,267 (GRCm39)	missense	probably damaging	1.00
R1657:Celsr3	UTSW	9	108,720,151 (GRCm39)	nonsense	probably null
R1753:Celsr3	UTSW	9	108,709,056 (GRCm39)	missense	probably damaging	0.99
R1764:Celsr3	UTSW	9	108,706,157 (GRCm39)	missense	probably damaging	1.00
R1801:Celsr3	UTSW	9	108,711,825 (GRCm39)	missense	possibly damaging	0.88
R1838:Celsr3	UTSW	9	108,707,105 (GRCm39)	missense	probably benign
R1839:Celsr3	UTSW	9	108,707,105 (GRCm39)	missense	probably benign
R1874:Celsr3	UTSW	9	108,713,037 (GRCm39)	missense	probably benign
R1875:Celsr3	UTSW	9	108,713,037 (GRCm39)	missense	probably benign
R1953:Celsr3	UTSW	9	108,720,381 (GRCm39)	missense	probably benign	0.19
R1960:Celsr3	UTSW	9	108,723,016 (GRCm39)	missense	probably benign
R2113:Celsr3	UTSW	9	108,715,669 (GRCm39)	missense	probably damaging	1.00
R2290:Celsr3	UTSW	9	108,720,423 (GRCm39)	missense	probably damaging	1.00
R2369:Celsr3	UTSW	9	108,719,751 (GRCm39)	missense	probably benign
R2373:Celsr3	UTSW	9	108,719,751 (GRCm39)	missense	probably benign
R2374:Celsr3	UTSW	9	108,719,751 (GRCm39)	missense	probably benign
R2375:Celsr3	UTSW	9	108,719,751 (GRCm39)	missense	probably benign
R2844:Celsr3	UTSW	9	108,706,507 (GRCm39)	missense	probably damaging	1.00
R2968:Celsr3	UTSW	9	108,709,390 (GRCm39)	missense	probably damaging	1.00
R3103:Celsr3	UTSW	9	108,714,338 (GRCm39)	missense	probably benign	0.31
R3159:Celsr3	UTSW	9	108,704,909 (GRCm39)	missense	possibly damaging	0.94
R3791:Celsr3	UTSW	9	108,719,751 (GRCm39)	missense	probably benign
R4194:Celsr3	UTSW	9	108,720,501 (GRCm39)	critical splice donor site	probably null
R4329:Celsr3	UTSW	9	108,723,248 (GRCm39)	missense	probably benign	0.00
R4365:Celsr3	UTSW	9	108,707,046 (GRCm39)	missense	possibly damaging	0.47
R4419:Celsr3	UTSW	9	108,720,443 (GRCm39)	missense	possibly damaging	0.84
R4484:Celsr3	UTSW	9	108,723,262 (GRCm39)	critical splice donor site	probably null
R4582:Celsr3	UTSW	9	108,722,922 (GRCm39)	missense	probably damaging	1.00
R4681:Celsr3	UTSW	9	108,704,953 (GRCm39)	missense	possibly damaging	0.58
R4729:Celsr3	UTSW	9	108,724,851 (GRCm39)	missense	probably benign	0.05
R4881:Celsr3	UTSW	9	108,721,140 (GRCm39)	missense	probably damaging	1.00
R4893:Celsr3	UTSW	9	108,726,620 (GRCm39)	missense	probably damaging	1.00
R5183:Celsr3	UTSW	9	108,714,759 (GRCm39)	missense	probably damaging	0.99
R5207:Celsr3	UTSW	9	108,709,958 (GRCm39)	missense	probably benign	0.01
R5290:Celsr3	UTSW	9	108,720,357 (GRCm39)	missense	probably benign	0.01
R5327:Celsr3	UTSW	9	108,719,907 (GRCm39)	intron	probably benign
R5345:Celsr3	UTSW	9	108,709,323 (GRCm39)	missense	probably damaging	1.00
R5358:Celsr3	UTSW	9	108,709,224 (GRCm39)	missense	possibly damaging	0.96
R5396:Celsr3	UTSW	9	108,705,781 (GRCm39)	missense	probably damaging	1.00
R5414:Celsr3	UTSW	9	108,717,241 (GRCm39)	missense	possibly damaging	0.88
R5452:Celsr3	UTSW	9	108,721,233 (GRCm39)	missense	possibly damaging	0.68
R5467:Celsr3	UTSW	9	108,705,836 (GRCm39)	missense	probably damaging	1.00
R5479:Celsr3	UTSW	9	108,721,743 (GRCm39)	critical splice donor site	probably null
R5629:Celsr3	UTSW	9	108,726,266 (GRCm39)	missense	probably benign	0.41
R5637:Celsr3	UTSW	9	108,714,332 (GRCm39)	missense	probably damaging	1.00
R5652:Celsr3	UTSW	9	108,715,671 (GRCm39)	missense	probably benign	0.03
R5739:Celsr3	UTSW	9	108,704,357 (GRCm39)	missense	probably benign
R5785:Celsr3	UTSW	9	108,704,996 (GRCm39)	missense	probably damaging	1.00
R5877:Celsr3	UTSW	9	108,722,926 (GRCm39)	missense	probably damaging	0.98
R5961:Celsr3	UTSW	9	108,708,993 (GRCm39)	missense	probably damaging	1.00
R6046:Celsr3	UTSW	9	108,714,350 (GRCm39)	missense	probably benign	0.01
R6176:Celsr3	UTSW	9	108,705,554 (GRCm39)	missense	probably damaging	1.00
R6291:Celsr3	UTSW	9	108,706,041 (GRCm39)	missense	probably damaging	1.00
R6468:Celsr3	UTSW	9	108,712,989 (GRCm39)	missense	probably benign	0.08
R6481:Celsr3	UTSW	9	108,714,283 (GRCm39)	missense	possibly damaging	0.92
R6547:Celsr3	UTSW	9	108,706,327 (GRCm39)	missense	probably damaging	1.00
R6763:Celsr3	UTSW	9	108,704,549 (GRCm39)	missense	probably damaging	1.00
R6870:Celsr3	UTSW	9	108,706,390 (GRCm39)	missense	probably benign	0.02
R6977:Celsr3	UTSW	9	108,704,914 (GRCm39)	missense	probably benign
R7061:Celsr3	UTSW	9	108,724,793 (GRCm39)	nonsense	probably null
R7122:Celsr3	UTSW	9	108,705,766 (GRCm39)	missense	possibly damaging	0.90
R7156:Celsr3	UTSW	9	108,715,203 (GRCm39)	missense	possibly damaging	0.95
R7166:Celsr3	UTSW	9	108,720,150 (GRCm39)	missense	probably damaging	1.00
R7176:Celsr3	UTSW	9	108,722,961 (GRCm39)	missense	probably benign
R7213:Celsr3	UTSW	9	108,726,239 (GRCm39)	missense	probably damaging	0.98
R7314:Celsr3	UTSW	9	108,706,343 (GRCm39)	missense	probably damaging	1.00
R7478:Celsr3	UTSW	9	108,720,777 (GRCm39)	missense	probably benign	0.37
R7508:Celsr3	UTSW	9	108,713,821 (GRCm39)	missense	probably benign
R7554:Celsr3	UTSW	9	108,718,408 (GRCm39)	missense	probably benign
R7615:Celsr3	UTSW	9	108,714,851 (GRCm39)	missense	possibly damaging	0.75
R7653:Celsr3	UTSW	9	108,712,269 (GRCm39)	nonsense	probably null
R7747:Celsr3	UTSW	9	108,707,177 (GRCm39)	missense	possibly damaging	0.61
R7881:Celsr3	UTSW	9	108,705,271 (GRCm39)	missense	probably benign	0.28
R7935:Celsr3	UTSW	9	108,706,840 (GRCm39)	missense	probably benign	0.01
R7995:Celsr3	UTSW	9	108,722,282 (GRCm39)	missense	probably damaging	0.99
R8006:Celsr3	UTSW	9	108,706,306 (GRCm39)	missense	probably damaging	1.00
R8077:Celsr3	UTSW	9	108,705,530 (GRCm39)	missense	probably benign	0.15
R8284:Celsr3	UTSW	9	108,723,612 (GRCm39)	missense	probably damaging	0.99
R8291:Celsr3	UTSW	9	108,715,169 (GRCm39)	missense	probably damaging	1.00
R8322:Celsr3	UTSW	9	108,725,993 (GRCm39)	missense	probably damaging	1.00
R8334:Celsr3	UTSW	9	108,718,471 (GRCm39)	frame shift	probably null
R8337:Celsr3	UTSW	9	108,718,471 (GRCm39)	frame shift	probably null
R8338:Celsr3	UTSW	9	108,704,539 (GRCm39)	nonsense	probably null
R8353:Celsr3	UTSW	9	108,703,734 (GRCm39)	missense	probably benign	0.00
R8407:Celsr3	UTSW	9	108,706,256 (GRCm39)	missense	probably damaging	1.00
R8408:Celsr3	UTSW	9	108,708,988 (GRCm39)	missense	probably damaging	1.00
R8459:Celsr3	UTSW	9	108,706,829 (GRCm39)	missense	probably damaging	1.00
R8510:Celsr3	UTSW	9	108,715,319 (GRCm39)	missense	possibly damaging	0.93
R8713:Celsr3	UTSW	9	108,707,062 (GRCm39)	missense	probably benign
R8728:Celsr3	UTSW	9	108,723,940 (GRCm39)	missense	probably benign	0.24
R8829:Celsr3	UTSW	9	108,717,582 (GRCm39)	missense	probably benign
R8877:Celsr3	UTSW	9	108,706,877 (GRCm39)	missense	probably damaging	1.00
R8905:Celsr3	UTSW	9	108,718,501 (GRCm39)	missense	probably damaging	1.00
R9008:Celsr3	UTSW	9	108,706,151 (GRCm39)	missense	possibly damaging	0.94
R9072:Celsr3	UTSW	9	108,704,293 (GRCm39)	missense	probably benign
R9157:Celsr3	UTSW	9	108,707,185 (GRCm39)	missense	probably damaging	1.00
R9183:Celsr3	UTSW	9	108,706,595 (GRCm39)	missense	probably damaging	1.00
R9275:Celsr3	UTSW	9	108,715,689 (GRCm39)	missense	probably benign	0.27
R9361:Celsr3	UTSW	9	108,726,521 (GRCm39)	missense	probably damaging	1.00
R9382:Celsr3	UTSW	9	108,706,961 (GRCm39)	missense	possibly damaging	0.60
R9407:Celsr3	UTSW	9	108,723,596 (GRCm39)	missense	probably damaging	1.00
R9432:Celsr3	UTSW	9	108,726,032 (GRCm39)	missense	probably benign	0.00
R9607:Celsr3	UTSW	9	108,717,701 (GRCm39)	critical splice donor site	probably null
R9626:Celsr3	UTSW	9	108,726,521 (GRCm39)	missense	probably damaging	1.00
R9628:Celsr3	UTSW	9	108,703,559 (GRCm39)	nonsense	probably null
R9630:Celsr3	UTSW	9	108,704,296 (GRCm39)	missense	probably benign
R9645:Celsr3	UTSW	9	108,704,691 (GRCm39)	nonsense	probably null
R9683:Celsr3	UTSW	9	108,704,522 (GRCm39)	missense	probably damaging	1.00
R9794:Celsr3	UTSW	9	108,728,502 (GRCm39)	missense	probably benign	0.00
R9798:Celsr3	UTSW	9	108,705,794 (GRCm39)	missense	probably damaging	1.00
RF020:Celsr3	UTSW	9	108,726,256 (GRCm39)	missense	probably benign
X0018:Celsr3	UTSW	9	108,717,611 (GRCm39)	missense	probably benign	0.01
X0018:Celsr3	UTSW	9	108,704,977 (GRCm39)	missense	possibly damaging	0.65
X0026:Celsr3	UTSW	9	108,706,129 (GRCm39)	missense	probably damaging	0.99
Z1177:Celsr3	UTSW	9	108,703,676 (GRCm39)	missense	probably benign	0.34

Predicted Primers

PCR Primer
(F):5'- TGAAGAACAGGTTGCAGTACCCAC -3'
(R):5'- ATCCTAGATAAAGAGTCCAGGGGCCG -3'

Sequencing Primer
(F):5'- AGAGTCGAGGCACTCCTGAG -3'
(R):5'- CCTTGAGAGTTGCCGCTG -3'

Posted On

2014-04-13