Incidental Mutation 'R1535:Pkn3'
ID166861
Institutional Source Beutler Lab
Gene Symbol Pkn3
Ensembl Gene ENSMUSG00000026785
Gene Nameprotein kinase N3
Synonyms
MMRRC Submission 039574-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1535 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location30077684-30091022 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30087053 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 602 (T602A)
Ref Sequence ENSEMBL: ENSMUSP00000041025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045246] [ENSMUST00000081838] [ENSMUST00000102865]
Predicted Effect probably benign
Transcript: ENSMUST00000045246
AA Change: T602A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041025
Gene: ENSMUSG00000026785
AA Change: T602A

DomainStartEndE-ValueType
Hr1 15 78 3.45e-17 SMART
Hr1 98 166 6.19e-19 SMART
Hr1 171 239 3.32e-19 SMART
low complexity region 528 537 N/A INTRINSIC
S_TKc 548 807 2.52e-93 SMART
S_TK_X 808 872 9.58e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081838
SMART Domains Protein: ENSMUSP00000080521
Gene: ENSMUSG00000015335

DomainStartEndE-ValueType
transmembrane domain 58 80 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
Pfam:zf-DHHC 106 232 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102865
SMART Domains Protein: ENSMUSP00000099929
Gene: ENSMUSG00000015335

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:zf-DHHC 58 218 1.1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156197
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable, fertile and healthy. Mice with conditional loss of this gene and Pten in hematopoietic cells show a delay in leukemia development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C T 9: 50,764,007 R40Q probably damaging Het
3110009E18Rik T C 1: 120,171,473 S99P possibly damaging Het
4932431P20Rik C T 7: 29,529,579 noncoding transcript Het
Abca16 T A 7: 120,540,705 I1530N probably benign Het
Abcc9 T G 6: 142,664,635 Q601P probably damaging Het
Acap3 A G 4: 155,896,174 probably benign Het
Adamts16 A T 13: 70,791,794 probably null Het
Alpk2 G C 18: 65,350,204 S244R probably benign Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Bend5 C A 4: 111,459,763 D374E probably benign Het
Catsperg2 T C 7: 29,698,246 D1014G possibly damaging Het
Ccer2 G T 7: 28,757,397 G189* probably null Het
Ces2h A G 8: 105,014,486 T37A probably benign Het
Cmah T C 13: 24,439,220 F213L probably damaging Het
Cntn2 T C 1: 132,525,384 E390G probably benign Het
Coq7 C T 7: 118,529,674 R46Q possibly damaging Het
Cpb1 T A 3: 20,266,287 D136V probably benign Het
Cxcr2 T C 1: 74,159,058 L237P probably damaging Het
Daam1 T C 12: 71,951,918 L549P unknown Het
Diaph1 A G 18: 37,896,093 probably null Het
Dis3 G T 14: 99,079,426 Q825K probably damaging Het
Dnah11 C T 12: 118,018,730 R2568Q probably damaging Het
Dnah12 A T 14: 26,816,322 R2312S possibly damaging Het
Dock9 C T 14: 121,546,064 E2041K probably damaging Het
Doxl2 T C 6: 48,975,464 F108L probably damaging Het
Eci1 A G 17: 24,439,090 E282G probably benign Het
Egf T A 3: 129,690,778 T464S probably benign Het
Eif4g3 C T 4: 138,097,302 P97S probably damaging Het
Emsy A G 7: 98,593,737 V1065A possibly damaging Het
Ep400 G T 5: 110,708,166 probably benign Het
Fam13a A C 6: 58,939,347 I607S probably damaging Het
Fam241b A G 10: 62,108,949 S113P probably damaging Het
Fbxl21 A T 13: 56,523,527 M1L probably benign Het
Fnip2 C A 3: 79,481,765 C553F probably damaging Het
Frmd3 G T 4: 74,013,758 probably benign Het
Gm597 T C 1: 28,777,424 E509G probably damaging Het
Gm9745 A T 13: 8,940,644 probably benign Het
Grm4 G A 17: 27,434,801 S470L probably benign Het
Gucy2e T A 11: 69,226,244 I784F probably damaging Het
H1fx T C 6: 87,981,148 Y70C probably damaging Het
Hmcn2 A T 2: 31,420,407 T3338S possibly damaging Het
Idh1 C T 1: 65,168,538 G161R probably damaging Het
Idi1 T C 13: 8,886,909 probably benign Het
Kcnq2 C T 2: 181,134,825 G90S probably damaging Het
Klhl29 A G 12: 5,084,486 Y642H probably damaging Het
Lmtk3 T A 7: 45,794,570 probably benign Het
Macf1 A T 4: 123,440,693 F4420I probably benign Het
Me1 A G 9: 86,587,043 S470P probably damaging Het
Mfsd2b A G 12: 4,870,605 S71P probably damaging Het
Mfsd3 T C 15: 76,702,779 L273P probably damaging Het
Mical1 A G 10: 41,485,211 K757R possibly damaging Het
Myh9 A T 15: 77,777,813 V782D probably damaging Het
Nab2 C G 10: 127,665,047 E59Q probably damaging Het
Nfyc A T 4: 120,761,724 N244K probably damaging Het
Nupr1l A G 5: 129,908,831 I80M probably damaging Het
Olfr1229 T C 2: 89,283,057 I46M probably benign Het
Olfr583 A G 7: 103,051,369 T24A probably benign Het
Olfr76 A G 19: 12,120,332 C115R probably damaging Het
Prrc2b T A 2: 32,204,289 V561D probably benign Het
Psd2 T A 18: 36,005,790 V489E probably benign Het
Rasal2 T C 1: 157,230,059 T181A probably benign Het
Serpinb13 T C 1: 106,982,156 M1T probably null Het
Sgsm1 A T 5: 113,263,269 S864T possibly damaging Het
Slc5a10 C A 11: 61,673,941 G404V possibly damaging Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Son A G 16: 91,659,734 K1790E probably damaging Het
Syde2 A G 3: 146,002,421 probably benign Het
Tmem126a T C 7: 90,452,818 I58V probably benign Het
Vmn2r8 T C 5: 108,802,174 Y269C probably damaging Het
Yeats2 T A 16: 20,189,365 S416T probably damaging Het
Zfp40 A T 17: 23,175,869 H513Q probably damaging Het
Other mutations in Pkn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Pkn3 APN 2 30081104 missense probably damaging 0.97
IGL00781:Pkn3 APN 2 30083390 unclassified probably benign
IGL00815:Pkn3 APN 2 30081200 missense possibly damaging 0.88
IGL01576:Pkn3 APN 2 30087042 missense probably damaging 1.00
IGL01897:Pkn3 APN 2 30082812 unclassified probably benign
IGL02513:Pkn3 APN 2 30083137 missense probably damaging 0.98
IGL02552:Pkn3 APN 2 30080867 missense probably damaging 1.00
IGL02622:Pkn3 APN 2 30083146 missense probably benign 0.28
IGL02689:Pkn3 APN 2 30080846 missense probably damaging 1.00
IGL02996:Pkn3 APN 2 30080615 missense probably benign 0.39
IGL03106:Pkn3 APN 2 30085245 missense probably damaging 0.96
Enflamme UTSW 2 30083037 unclassified probably benign
Wrath UTSW 2 30088584 critical splice donor site probably null
PIT4151001:Pkn3 UTSW 2 30090527 missense probably damaging 1.00
R0279:Pkn3 UTSW 2 30083297 missense probably benign 0.16
R0370:Pkn3 UTSW 2 30087172 missense probably damaging 1.00
R0491:Pkn3 UTSW 2 30089877 missense probably damaging 1.00
R0600:Pkn3 UTSW 2 30081134 missense probably benign 0.06
R1418:Pkn3 UTSW 2 30083047 missense probably damaging 1.00
R1510:Pkn3 UTSW 2 30079764 critical splice donor site probably null
R1540:Pkn3 UTSW 2 30084691 missense probably damaging 1.00
R1808:Pkn3 UTSW 2 30079651 missense probably damaging 1.00
R1884:Pkn3 UTSW 2 30082828 missense probably damaging 1.00
R1995:Pkn3 UTSW 2 30089977 missense probably damaging 1.00
R3745:Pkn3 UTSW 2 30090341 missense probably damaging 1.00
R4119:Pkn3 UTSW 2 30083037 unclassified probably benign
R4258:Pkn3 UTSW 2 30088560 missense probably damaging 0.99
R4665:Pkn3 UTSW 2 30085457 unclassified probably benign
R4772:Pkn3 UTSW 2 30084680 splice site probably null
R4808:Pkn3 UTSW 2 30090081 missense probably damaging 1.00
R5038:Pkn3 UTSW 2 30085281 critical splice donor site probably null
R5388:Pkn3 UTSW 2 30081074 missense probably damaging 0.99
R5488:Pkn3 UTSW 2 30088584 critical splice donor site probably null
R5611:Pkn3 UTSW 2 30079661 missense probably damaging 1.00
R6001:Pkn3 UTSW 2 30088584 critical splice donor site probably null
R6277:Pkn3 UTSW 2 30082945 missense possibly damaging 0.93
R6562:Pkn3 UTSW 2 30080687 critical splice donor site probably null
R6724:Pkn3 UTSW 2 30090550 missense possibly damaging 0.94
R7061:Pkn3 UTSW 2 30083536 intron probably null
R7128:Pkn3 UTSW 2 30083315 missense probably damaging 1.00
R7249:Pkn3 UTSW 2 30084761 missense probably benign 0.00
R7475:Pkn3 UTSW 2 30087110 missense probably benign 0.01
R7746:Pkn3 UTSW 2 30090584 missense probably benign 0.00
R7747:Pkn3 UTSW 2 30090584 missense probably benign 0.00
R7783:Pkn3 UTSW 2 30079622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCTTCCCCATGTGTGAACC -3'
(R):5'- CCACGGCTATGCAAATGAAGTCCTC -3'

Sequencing Primer
(F):5'- ATGTGTGAACCATCAACTTGCC -3'
(R):5'- TGTTGTAATGTCCCACCAAGAC -3'
Posted On2014-04-13