Incidental Mutation 'R1535:Syde2'
ID166871
Institutional Source Beutler Lab
Gene Symbol Syde2
Ensembl Gene ENSMUSG00000036863
Gene Namesynapse defective 1, Rho GTPase, homolog 2 (C. elegans)
SynonymsC430017H16Rik
MMRRC Submission 039574-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R1535 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location145987870-146021720 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 146002421 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039517] [ENSMUST00000200546] [ENSMUST00000212479]
Predicted Effect probably benign
Transcript: ENSMUST00000039517
SMART Domains Protein: ENSMUSP00000041897
Gene: ENSMUSG00000036863

DomainStartEndE-ValueType
low complexity region 65 98 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 164 185 N/A INTRINSIC
low complexity region 197 221 N/A INTRINSIC
low complexity region 623 636 N/A INTRINSIC
C2 802 902 1.1e0 SMART
RhoGAP 950 1149 1.23e-57 SMART
Blast:RhoGAP 1151 1299 2e-50 BLAST
low complexity region 1300 1311 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195918
Predicted Effect probably benign
Transcript: ENSMUST00000200546
SMART Domains Protein: ENSMUSP00000142954
Gene: ENSMUSG00000036863

DomainStartEndE-ValueType
low complexity region 355 368 N/A INTRINSIC
C2 534 634 7.2e-3 SMART
RhoGAP 682 881 7.3e-60 SMART
Blast:RhoGAP 883 1031 2e-50 BLAST
low complexity region 1032 1043 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212479
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C T 9: 50,764,007 R40Q probably damaging Het
3110009E18Rik T C 1: 120,171,473 S99P possibly damaging Het
4932431P20Rik C T 7: 29,529,579 noncoding transcript Het
Abca16 T A 7: 120,540,705 I1530N probably benign Het
Abcc9 T G 6: 142,664,635 Q601P probably damaging Het
Acap3 A G 4: 155,896,174 probably benign Het
Adamts16 A T 13: 70,791,794 probably null Het
Alpk2 G C 18: 65,350,204 S244R probably benign Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Bend5 C A 4: 111,459,763 D374E probably benign Het
Catsperg2 T C 7: 29,698,246 D1014G possibly damaging Het
Ccer2 G T 7: 28,757,397 G189* probably null Het
Ces2h A G 8: 105,014,486 T37A probably benign Het
Cmah T C 13: 24,439,220 F213L probably damaging Het
Cntn2 T C 1: 132,525,384 E390G probably benign Het
Coq7 C T 7: 118,529,674 R46Q possibly damaging Het
Cpb1 T A 3: 20,266,287 D136V probably benign Het
Cxcr2 T C 1: 74,159,058 L237P probably damaging Het
Daam1 T C 12: 71,951,918 L549P unknown Het
Diaph1 A G 18: 37,896,093 probably null Het
Dis3 G T 14: 99,079,426 Q825K probably damaging Het
Dnah11 C T 12: 118,018,730 R2568Q probably damaging Het
Dnah12 A T 14: 26,816,322 R2312S possibly damaging Het
Dock9 C T 14: 121,546,064 E2041K probably damaging Het
Doxl2 T C 6: 48,975,464 F108L probably damaging Het
Eci1 A G 17: 24,439,090 E282G probably benign Het
Egf T A 3: 129,690,778 T464S probably benign Het
Eif4g3 C T 4: 138,097,302 P97S probably damaging Het
Emsy A G 7: 98,593,737 V1065A possibly damaging Het
Ep400 G T 5: 110,708,166 probably benign Het
Fam13a A C 6: 58,939,347 I607S probably damaging Het
Fam241b A G 10: 62,108,949 S113P probably damaging Het
Fbxl21 A T 13: 56,523,527 M1L probably benign Het
Fnip2 C A 3: 79,481,765 C553F probably damaging Het
Frmd3 G T 4: 74,013,758 probably benign Het
Gm597 T C 1: 28,777,424 E509G probably damaging Het
Gm9745 A T 13: 8,940,644 probably benign Het
Grm4 G A 17: 27,434,801 S470L probably benign Het
Gucy2e T A 11: 69,226,244 I784F probably damaging Het
H1fx T C 6: 87,981,148 Y70C probably damaging Het
Hmcn2 A T 2: 31,420,407 T3338S possibly damaging Het
Idh1 C T 1: 65,168,538 G161R probably damaging Het
Idi1 T C 13: 8,886,909 probably benign Het
Kcnq2 C T 2: 181,134,825 G90S probably damaging Het
Klhl29 A G 12: 5,084,486 Y642H probably damaging Het
Lmtk3 T A 7: 45,794,570 probably benign Het
Macf1 A T 4: 123,440,693 F4420I probably benign Het
Me1 A G 9: 86,587,043 S470P probably damaging Het
Mfsd2b A G 12: 4,870,605 S71P probably damaging Het
Mfsd3 T C 15: 76,702,779 L273P probably damaging Het
Mical1 A G 10: 41,485,211 K757R possibly damaging Het
Myh9 A T 15: 77,777,813 V782D probably damaging Het
Nab2 C G 10: 127,665,047 E59Q probably damaging Het
Nfyc A T 4: 120,761,724 N244K probably damaging Het
Nupr1l A G 5: 129,908,831 I80M probably damaging Het
Olfr1229 T C 2: 89,283,057 I46M probably benign Het
Olfr583 A G 7: 103,051,369 T24A probably benign Het
Olfr76 A G 19: 12,120,332 C115R probably damaging Het
Pkn3 A G 2: 30,087,053 T602A probably benign Het
Prrc2b T A 2: 32,204,289 V561D probably benign Het
Psd2 T A 18: 36,005,790 V489E probably benign Het
Rasal2 T C 1: 157,230,059 T181A probably benign Het
Serpinb13 T C 1: 106,982,156 M1T probably null Het
Sgsm1 A T 5: 113,263,269 S864T possibly damaging Het
Slc5a10 C A 11: 61,673,941 G404V possibly damaging Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Son A G 16: 91,659,734 K1790E probably damaging Het
Tmem126a T C 7: 90,452,818 I58V probably benign Het
Vmn2r8 T C 5: 108,802,174 Y269C probably damaging Het
Yeats2 T A 16: 20,189,365 S416T probably damaging Het
Zfp40 A T 17: 23,175,869 H513Q probably damaging Het
Other mutations in Syde2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Syde2 APN 3 146014341 missense possibly damaging 0.76
IGL01624:Syde2 APN 3 146007035 missense probably damaging 1.00
IGL02059:Syde2 APN 3 146002172 missense possibly damaging 0.77
IGL02195:Syde2 APN 3 146002156 missense probably damaging 1.00
IGL02498:Syde2 APN 3 145998689 missense probably benign 0.08
IGL02609:Syde2 APN 3 145998520 missense probably benign 0.00
IGL02721:Syde2 APN 3 146002004 missense probably damaging 1.00
IGL02932:Syde2 APN 3 146001476 missense possibly damaging 0.79
IGL02957:Syde2 APN 3 145989179 splice site probably benign
R0062:Syde2 UTSW 3 145998753 missense probably benign 0.00
R0062:Syde2 UTSW 3 145998753 missense probably benign 0.00
R0413:Syde2 UTSW 3 146007132 missense probably damaging 1.00
R0505:Syde2 UTSW 3 146014380 missense possibly damaging 0.85
R0535:Syde2 UTSW 3 145989170 critical splice donor site probably null
R0646:Syde2 UTSW 3 146014249 splice site probably null
R1914:Syde2 UTSW 3 146014316 nonsense probably null
R1915:Syde2 UTSW 3 146014316 nonsense probably null
R1997:Syde2 UTSW 3 145998991 missense probably benign 0.08
R2012:Syde2 UTSW 3 145988408 missense possibly damaging 0.88
R2112:Syde2 UTSW 3 145998486 missense possibly damaging 0.52
R2220:Syde2 UTSW 3 146001958 missense probably benign 0.07
R2990:Syde2 UTSW 3 146001497 missense probably damaging 0.97
R4022:Syde2 UTSW 3 146015725 missense probably benign 0.25
R5077:Syde2 UTSW 3 146002009 missense probably damaging 1.00
R5084:Syde2 UTSW 3 146001409 frame shift probably null
R5084:Syde2 UTSW 3 146001408 nonsense probably null
R5086:Syde2 UTSW 3 146001408 nonsense probably null
R5087:Syde2 UTSW 3 146001408 nonsense probably null
R5087:Syde2 UTSW 3 146007126 missense probably damaging 1.00
R5101:Syde2 UTSW 3 146015638 missense probably damaging 1.00
R5211:Syde2 UTSW 3 146001338 missense probably benign 0.01
R5842:Syde2 UTSW 3 145999020 missense probably benign 0.00
R6025:Syde2 UTSW 3 146007141 splice site probably null
R6352:Syde2 UTSW 3 145998474 nonsense probably null
R6384:Syde2 UTSW 3 145998813 missense probably damaging 1.00
R6769:Syde2 UTSW 3 145999048 missense probably damaging 0.98
R6771:Syde2 UTSW 3 145999048 missense probably damaging 0.98
R6970:Syde2 UTSW 3 145988626 missense probably benign 0.15
R6988:Syde2 UTSW 3 146019809 missense probably benign 0.31
R7067:Syde2 UTSW 3 145988264 missense probably benign 0.00
R7146:Syde2 UTSW 3 146007115 nonsense probably null
R7191:Syde2 UTSW 3 146002358 missense probably benign 0.04
R7246:Syde2 UTSW 3 145988755 missense probably benign 0.22
R7271:Syde2 UTSW 3 146020276 missense possibly damaging 0.71
R7307:Syde2 UTSW 3 146015798 missense probably damaging 1.00
R7875:Syde2 UTSW 3 146020265 missense probably damaging 1.00
R7903:Syde2 UTSW 3 145998788 missense probably damaging 1.00
R7918:Syde2 UTSW 3 146002415 critical splice donor site probably null
R8016:Syde2 UTSW 3 146001972 missense possibly damaging 0.82
R8185:Syde2 UTSW 3 145988912 missense probably benign
R8328:Syde2 UTSW 3 146015741 missense probably benign 0.31
R8913:Syde2 UTSW 3 146002393 missense not run
Predicted Primers PCR Primer
(F):5'- TCTCTGCACGGCCTGGATAAGAAC -3'
(R):5'- AAGAGCTGAGCCTTTCTGTGTCATC -3'

Sequencing Primer
(F):5'- ACCGCGAAGCGGTGATG -3'
(R):5'- CTTCTCCTGACAAGTCACTGTAAAG -3'
Posted On2014-04-13