Incidental Mutation 'R1535:Ccer2'
ID166889
Institutional Source Beutler Lab
Gene Symbol Ccer2
Ensembl Gene ENSMUSG00000096257
Gene Namecoiled-coil glutamate-rich protein 2
SynonymsGm6537
MMRRC Submission 039574-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R1535 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28756174-28758968 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 28757397 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 189 (G189*)
Ref Sequence ENSEMBL: ENSMUSP00000137487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032815] [ENSMUST00000085851] [ENSMUST00000094632] [ENSMUST00000137121] [ENSMUST00000178767]
Predicted Effect probably benign
Transcript: ENSMUST00000032815
SMART Domains Protein: ENSMUSP00000032815
Gene: ENSMUSG00000030595

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
ANK 57 86 4.13e-2 SMART
ANK 93 122 1.6e1 SMART
ANK 126 155 5.98e1 SMART
low complexity region 183 191 N/A INTRINSIC
ANK 206 235 5.12e-7 SMART
ANK 240 269 1.76e-5 SMART
ANK 273 303 1.37e2 SMART
low complexity region 305 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085851
SMART Domains Protein: ENSMUSP00000083012
Gene: ENSMUSG00000030595

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
ANK 57 86 4.13e-2 SMART
ANK 93 122 1.6e1 SMART
ANK 126 155 5.98e1 SMART
low complexity region 183 191 N/A INTRINSIC
ANK 206 235 5.12e-7 SMART
ANK 240 269 1.76e-5 SMART
ANK 273 303 1.37e2 SMART
low complexity region 305 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094632
SMART Domains Protein: ENSMUSP00000092216
Gene: ENSMUSG00000070699

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 58 174 3.8e-8 PFAM
Pfam:tRNA-synt_2b 284 468 5.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137121
SMART Domains Protein: ENSMUSP00000117769
Gene: ENSMUSG00000030595

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
ANK 57 86 4.13e-2 SMART
ANK 93 122 1.6e1 SMART
ANK 126 151 2.15e3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000178767
AA Change: G189*
SMART Domains Protein: ENSMUSP00000137487
Gene: ENSMUSG00000096257
AA Change: G189*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 105 117 N/A INTRINSIC
coiled coil region 129 151 N/A INTRINSIC
low complexity region 206 215 N/A INTRINSIC
coiled coil region 228 270 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C T 9: 50,764,007 R40Q probably damaging Het
3110009E18Rik T C 1: 120,171,473 S99P possibly damaging Het
4932431P20Rik C T 7: 29,529,579 noncoding transcript Het
Abca16 T A 7: 120,540,705 I1530N probably benign Het
Abcc9 T G 6: 142,664,635 Q601P probably damaging Het
Acap3 A G 4: 155,896,174 probably benign Het
Adamts16 A T 13: 70,791,794 probably null Het
Alpk2 G C 18: 65,350,204 S244R probably benign Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Bend5 C A 4: 111,459,763 D374E probably benign Het
Catsperg2 T C 7: 29,698,246 D1014G possibly damaging Het
Ces2h A G 8: 105,014,486 T37A probably benign Het
Cmah T C 13: 24,439,220 F213L probably damaging Het
Cntn2 T C 1: 132,525,384 E390G probably benign Het
Coq7 C T 7: 118,529,674 R46Q possibly damaging Het
Cpb1 T A 3: 20,266,287 D136V probably benign Het
Cxcr2 T C 1: 74,159,058 L237P probably damaging Het
Daam1 T C 12: 71,951,918 L549P unknown Het
Diaph1 A G 18: 37,896,093 probably null Het
Dis3 G T 14: 99,079,426 Q825K probably damaging Het
Dnah11 C T 12: 118,018,730 R2568Q probably damaging Het
Dnah12 A T 14: 26,816,322 R2312S possibly damaging Het
Dock9 C T 14: 121,546,064 E2041K probably damaging Het
Doxl2 T C 6: 48,975,464 F108L probably damaging Het
Eci1 A G 17: 24,439,090 E282G probably benign Het
Egf T A 3: 129,690,778 T464S probably benign Het
Eif4g3 C T 4: 138,097,302 P97S probably damaging Het
Emsy A G 7: 98,593,737 V1065A possibly damaging Het
Ep400 G T 5: 110,708,166 probably benign Het
Fam13a A C 6: 58,939,347 I607S probably damaging Het
Fam241b A G 10: 62,108,949 S113P probably damaging Het
Fbxl21 A T 13: 56,523,527 M1L probably benign Het
Fnip2 C A 3: 79,481,765 C553F probably damaging Het
Frmd3 G T 4: 74,013,758 probably benign Het
Gm597 T C 1: 28,777,424 E509G probably damaging Het
Gm9745 A T 13: 8,940,644 probably benign Het
Grm4 G A 17: 27,434,801 S470L probably benign Het
Gucy2e T A 11: 69,226,244 I784F probably damaging Het
H1fx T C 6: 87,981,148 Y70C probably damaging Het
Hmcn2 A T 2: 31,420,407 T3338S possibly damaging Het
Idh1 C T 1: 65,168,538 G161R probably damaging Het
Idi1 T C 13: 8,886,909 probably benign Het
Kcnq2 C T 2: 181,134,825 G90S probably damaging Het
Klhl29 A G 12: 5,084,486 Y642H probably damaging Het
Lmtk3 T A 7: 45,794,570 probably benign Het
Macf1 A T 4: 123,440,693 F4420I probably benign Het
Me1 A G 9: 86,587,043 S470P probably damaging Het
Mfsd2b A G 12: 4,870,605 S71P probably damaging Het
Mfsd3 T C 15: 76,702,779 L273P probably damaging Het
Mical1 A G 10: 41,485,211 K757R possibly damaging Het
Myh9 A T 15: 77,777,813 V782D probably damaging Het
Nab2 C G 10: 127,665,047 E59Q probably damaging Het
Nfyc A T 4: 120,761,724 N244K probably damaging Het
Nupr1l A G 5: 129,908,831 I80M probably damaging Het
Olfr1229 T C 2: 89,283,057 I46M probably benign Het
Olfr583 A G 7: 103,051,369 T24A probably benign Het
Olfr76 A G 19: 12,120,332 C115R probably damaging Het
Pkn3 A G 2: 30,087,053 T602A probably benign Het
Prrc2b T A 2: 32,204,289 V561D probably benign Het
Psd2 T A 18: 36,005,790 V489E probably benign Het
Rasal2 T C 1: 157,230,059 T181A probably benign Het
Serpinb13 T C 1: 106,982,156 M1T probably null Het
Sgsm1 A T 5: 113,263,269 S864T possibly damaging Het
Slc5a10 C A 11: 61,673,941 G404V possibly damaging Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Son A G 16: 91,659,734 K1790E probably damaging Het
Syde2 A G 3: 146,002,421 probably benign Het
Tmem126a T C 7: 90,452,818 I58V probably benign Het
Vmn2r8 T C 5: 108,802,174 Y269C probably damaging Het
Yeats2 T A 16: 20,189,365 S416T probably damaging Het
Zfp40 A T 17: 23,175,869 H513Q probably damaging Het
Other mutations in Ccer2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0581:Ccer2 UTSW 7 28757026 splice site probably benign
R1987:Ccer2 UTSW 7 28757283 missense possibly damaging 0.83
R4664:Ccer2 UTSW 7 28756503 missense probably benign 0.36
R5690:Ccer2 UTSW 7 28756204 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CAGGACAGTTTCCCGAAGAGCATC -3'
(R):5'- TGACCCACATCATGGCAGATTTCAC -3'

Sequencing Primer
(F):5'- TCCCTGCCAGAGATATTTGAGAC -3'
(R):5'- TTGTGCAGTTCAGCACCAG -3'
Posted On2014-04-13