Incidental Mutation 'R1535:4932431P20Rik'
ID166890
Institutional Source Beutler Lab
Gene Symbol 4932431P20Rik
Ensembl Gene ENSMUSG00000074224
Gene NameRIKEN cDNA 4932431P20 gene
Synonyms
MMRRC Submission 039574-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1535 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29519205-29538057 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) C to T at 29529579 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141713
SMART Domains Protein: ENSMUSP00000120285
Gene: ENSMUSG00000074224

DomainStartEndE-ValueType
Blast:WD40 94 134 1e-9 BLAST
WD40 139 176 1.59e1 SMART
WD40 228 269 9.51e1 SMART
WD40 272 311 3.33e-1 SMART
Blast:WD40 354 393 4e-15 BLAST
Blast:WD40 445 490 2e-22 BLAST
Blast:WD40 493 538 8e-15 BLAST
WD40 595 634 1.68e-6 SMART
low complexity region 701 710 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
coiled coil region 1135 1168 N/A INTRINSIC
low complexity region 1211 1230 N/A INTRINSIC
low complexity region 1239 1273 N/A INTRINSIC
coiled coil region 1347 1375 N/A INTRINSIC
coiled coil region 1399 1433 N/A INTRINSIC
low complexity region 1435 1453 N/A INTRINSIC
low complexity region 1497 1519 N/A INTRINSIC
coiled coil region 1612 1707 N/A INTRINSIC
coiled coil region 1731 1989 N/A INTRINSIC
coiled coil region 2034 2072 N/A INTRINSIC
coiled coil region 2127 2154 N/A INTRINSIC
coiled coil region 2220 2302 N/A INTRINSIC
coiled coil region 2357 2561 N/A INTRINSIC
low complexity region 2993 2999 N/A INTRINSIC
Meta Mutation Damage Score 0.1105 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C T 9: 50,764,007 R40Q probably damaging Het
3110009E18Rik T C 1: 120,171,473 S99P possibly damaging Het
Abca16 T A 7: 120,540,705 I1530N probably benign Het
Abcc9 T G 6: 142,664,635 Q601P probably damaging Het
Acap3 A G 4: 155,896,174 probably benign Het
Adamts16 A T 13: 70,791,794 probably null Het
Alpk2 G C 18: 65,350,204 S244R probably benign Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Bend5 C A 4: 111,459,763 D374E probably benign Het
Catsperg2 T C 7: 29,698,246 D1014G possibly damaging Het
Ccer2 G T 7: 28,757,397 G189* probably null Het
Ces2h A G 8: 105,014,486 T37A probably benign Het
Cmah T C 13: 24,439,220 F213L probably damaging Het
Cntn2 T C 1: 132,525,384 E390G probably benign Het
Coq7 C T 7: 118,529,674 R46Q possibly damaging Het
Cpb1 T A 3: 20,266,287 D136V probably benign Het
Cxcr2 T C 1: 74,159,058 L237P probably damaging Het
Daam1 T C 12: 71,951,918 L549P unknown Het
Diaph1 A G 18: 37,896,093 probably null Het
Dis3 G T 14: 99,079,426 Q825K probably damaging Het
Dnah11 C T 12: 118,018,730 R2568Q probably damaging Het
Dnah12 A T 14: 26,816,322 R2312S possibly damaging Het
Dock9 C T 14: 121,546,064 E2041K probably damaging Het
Doxl2 T C 6: 48,975,464 F108L probably damaging Het
Eci1 A G 17: 24,439,090 E282G probably benign Het
Egf T A 3: 129,690,778 T464S probably benign Het
Eif4g3 C T 4: 138,097,302 P97S probably damaging Het
Emsy A G 7: 98,593,737 V1065A possibly damaging Het
Ep400 G T 5: 110,708,166 probably benign Het
Fam13a A C 6: 58,939,347 I607S probably damaging Het
Fam241b A G 10: 62,108,949 S113P probably damaging Het
Fbxl21 A T 13: 56,523,527 M1L probably benign Het
Fnip2 C A 3: 79,481,765 C553F probably damaging Het
Frmd3 G T 4: 74,013,758 probably benign Het
Gm597 T C 1: 28,777,424 E509G probably damaging Het
Gm9745 A T 13: 8,940,644 probably benign Het
Grm4 G A 17: 27,434,801 S470L probably benign Het
Gucy2e T A 11: 69,226,244 I784F probably damaging Het
H1fx T C 6: 87,981,148 Y70C probably damaging Het
Hmcn2 A T 2: 31,420,407 T3338S possibly damaging Het
Idh1 C T 1: 65,168,538 G161R probably damaging Het
Idi1 T C 13: 8,886,909 probably benign Het
Kcnq2 C T 2: 181,134,825 G90S probably damaging Het
Klhl29 A G 12: 5,084,486 Y642H probably damaging Het
Lmtk3 T A 7: 45,794,570 probably benign Het
Macf1 A T 4: 123,440,693 F4420I probably benign Het
Me1 A G 9: 86,587,043 S470P probably damaging Het
Mfsd2b A G 12: 4,870,605 S71P probably damaging Het
Mfsd3 T C 15: 76,702,779 L273P probably damaging Het
Mical1 A G 10: 41,485,211 K757R possibly damaging Het
Myh9 A T 15: 77,777,813 V782D probably damaging Het
Nab2 C G 10: 127,665,047 E59Q probably damaging Het
Nfyc A T 4: 120,761,724 N244K probably damaging Het
Nupr1l A G 5: 129,908,831 I80M probably damaging Het
Olfr1229 T C 2: 89,283,057 I46M probably benign Het
Olfr583 A G 7: 103,051,369 T24A probably benign Het
Olfr76 A G 19: 12,120,332 C115R probably damaging Het
Pkn3 A G 2: 30,087,053 T602A probably benign Het
Prrc2b T A 2: 32,204,289 V561D probably benign Het
Psd2 T A 18: 36,005,790 V489E probably benign Het
Rasal2 T C 1: 157,230,059 T181A probably benign Het
Serpinb13 T C 1: 106,982,156 M1T probably null Het
Sgsm1 A T 5: 113,263,269 S864T possibly damaging Het
Slc5a10 C A 11: 61,673,941 G404V possibly damaging Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Son A G 16: 91,659,734 K1790E probably damaging Het
Syde2 A G 3: 146,002,421 probably benign Het
Tmem126a T C 7: 90,452,818 I58V probably benign Het
Vmn2r8 T C 5: 108,802,174 Y269C probably damaging Het
Yeats2 T A 16: 20,189,365 S416T probably damaging Het
Zfp40 A T 17: 23,175,869 H513Q probably damaging Het
Other mutations in 4932431P20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:4932431P20Rik APN 7 29537622 exon noncoding transcript
IGL00505:4932431P20Rik APN 7 29534183 exon noncoding transcript
IGL00557:4932431P20Rik APN 7 29535802 exon noncoding transcript
IGL00569:4932431P20Rik APN 7 29534140 exon noncoding transcript
IGL00966:4932431P20Rik APN 7 29537463 exon noncoding transcript
IGL01668:4932431P20Rik APN 7 29537430 exon noncoding transcript
K7371:4932431P20Rik UTSW 7 29530992 exon noncoding transcript
P0037:4932431P20Rik UTSW 7 29533614 exon noncoding transcript
R0179:4932431P20Rik UTSW 7 29535940 exon noncoding transcript
R0357:4932431P20Rik UTSW 7 29535582 exon noncoding transcript
R0358:4932431P20Rik UTSW 7 29532211 exon noncoding transcript
R0412:4932431P20Rik UTSW 7 29530570 exon noncoding transcript
R0530:4932431P20Rik UTSW 7 29530120 exon noncoding transcript
R0600:4932431P20Rik UTSW 7 29533265 exon noncoding transcript
R0675:4932431P20Rik UTSW 7 29532517 exon noncoding transcript
R1118:4932431P20Rik UTSW 7 29534244 exon noncoding transcript
R1395:4932431P20Rik UTSW 7 29531387 exon noncoding transcript
R1444:4932431P20Rik UTSW 7 29529955 exon noncoding transcript
R1476:4932431P20Rik UTSW 7 29534890 exon noncoding transcript
R1534:4932431P20Rik UTSW 7 29530429 exon noncoding transcript
R2023:4932431P20Rik UTSW 7 29531534 exon noncoding transcript
R2127:4932431P20Rik UTSW 7 29537140 exon noncoding transcript
R2141:4932431P20Rik UTSW 7 29531510 exon noncoding transcript
R2198:4932431P20Rik UTSW 7 29527272 exon noncoding transcript
R2201:4932431P20Rik UTSW 7 29536525 exon noncoding transcript
R2262:4932431P20Rik UTSW 7 29532562 exon noncoding transcript
R2263:4932431P20Rik UTSW 7 29532562 exon noncoding transcript
R4874:4932431P20Rik UTSW 7 29536183 exon noncoding transcript
R5064:4932431P20Rik UTSW 7 29535655 exon noncoding transcript
R5130:4932431P20Rik UTSW 7 29529274 exon noncoding transcript
R5366:4932431P20Rik UTSW 7 29533539 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- AGTACTCGACCATGCTGTGGACTG -3'
(R):5'- TGATGCCTTGACTTGACCCAAACG -3'

Sequencing Primer
(F):5'- GATATTCAGGACTACGTCCAGTGC -3'
(R):5'- TTGACTTGACCCAAACGATATAAAC -3'
Posted On2014-04-13