Incidental Mutation 'R1535:Me1'
ID166901
Institutional Source Beutler Lab
Gene Symbol Me1
Ensembl Gene ENSMUSG00000032418
Gene Namemalic enzyme 1, NADP(+)-dependent, cytosolic
SynonymsMod-1, Mdh-1, Mod1, D9Ertd267e
MMRRC Submission 039574-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1535 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location86581371-86695953 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86587043 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 470 (S470P)
Ref Sequence ENSEMBL: ENSMUSP00000140887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034989] [ENSMUST00000185374]
Predicted Effect probably damaging
Transcript: ENSMUST00000034989
AA Change: S490P

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034989
Gene: ENSMUSG00000032418
AA Change: S490P

DomainStartEndE-ValueType
malic 79 260 7.34e-106 SMART
Malic_M 270 522 1.09e-111 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185374
AA Change: S470P

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140887
Gene: ENSMUSG00000032418
AA Change: S470P

DomainStartEndE-ValueType
malic 59 240 7.34e-106 SMART
Malic_M 250 502 1.09e-111 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189968
Meta Mutation Damage Score 0.2118 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic, NADP-dependent enzyme that generates NADPH for fatty acid biosynthesis. The activity of this enzyme, the reversible oxidative decarboxylation of malate, links the glycolytic and citric acid cycles. The regulation of expression for this gene is complex. Increased expression can result from elevated levels of thyroid hormones or by higher proportions of carbohydrates in the diet. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit decreased body weight on a medium fat diet, altered cytoplasmic malic enzyme activity, and a male-specific reduction in food intake on a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C T 9: 50,764,007 R40Q probably damaging Het
3110009E18Rik T C 1: 120,171,473 S99P possibly damaging Het
4932431P20Rik C T 7: 29,529,579 noncoding transcript Het
Abca16 T A 7: 120,540,705 I1530N probably benign Het
Abcc9 T G 6: 142,664,635 Q601P probably damaging Het
Acap3 A G 4: 155,896,174 probably benign Het
Adamts16 A T 13: 70,791,794 probably null Het
Alpk2 G C 18: 65,350,204 S244R probably benign Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Bend5 C A 4: 111,459,763 D374E probably benign Het
Catsperg2 T C 7: 29,698,246 D1014G possibly damaging Het
Ccer2 G T 7: 28,757,397 G189* probably null Het
Ces2h A G 8: 105,014,486 T37A probably benign Het
Cmah T C 13: 24,439,220 F213L probably damaging Het
Cntn2 T C 1: 132,525,384 E390G probably benign Het
Coq7 C T 7: 118,529,674 R46Q possibly damaging Het
Cpb1 T A 3: 20,266,287 D136V probably benign Het
Cxcr2 T C 1: 74,159,058 L237P probably damaging Het
Daam1 T C 12: 71,951,918 L549P unknown Het
Diaph1 A G 18: 37,896,093 probably null Het
Dis3 G T 14: 99,079,426 Q825K probably damaging Het
Dnah11 C T 12: 118,018,730 R2568Q probably damaging Het
Dnah12 A T 14: 26,816,322 R2312S possibly damaging Het
Dock9 C T 14: 121,546,064 E2041K probably damaging Het
Doxl2 T C 6: 48,975,464 F108L probably damaging Het
Eci1 A G 17: 24,439,090 E282G probably benign Het
Egf T A 3: 129,690,778 T464S probably benign Het
Eif4g3 C T 4: 138,097,302 P97S probably damaging Het
Emsy A G 7: 98,593,737 V1065A possibly damaging Het
Ep400 G T 5: 110,708,166 probably benign Het
Fam13a A C 6: 58,939,347 I607S probably damaging Het
Fam241b A G 10: 62,108,949 S113P probably damaging Het
Fbxl21 A T 13: 56,523,527 M1L probably benign Het
Fnip2 C A 3: 79,481,765 C553F probably damaging Het
Frmd3 G T 4: 74,013,758 probably benign Het
Gm597 T C 1: 28,777,424 E509G probably damaging Het
Gm9745 A T 13: 8,940,644 probably benign Het
Grm4 G A 17: 27,434,801 S470L probably benign Het
Gucy2e T A 11: 69,226,244 I784F probably damaging Het
H1fx T C 6: 87,981,148 Y70C probably damaging Het
Hmcn2 A T 2: 31,420,407 T3338S possibly damaging Het
Idh1 C T 1: 65,168,538 G161R probably damaging Het
Idi1 T C 13: 8,886,909 probably benign Het
Kcnq2 C T 2: 181,134,825 G90S probably damaging Het
Klhl29 A G 12: 5,084,486 Y642H probably damaging Het
Lmtk3 T A 7: 45,794,570 probably benign Het
Macf1 A T 4: 123,440,693 F4420I probably benign Het
Mfsd2b A G 12: 4,870,605 S71P probably damaging Het
Mfsd3 T C 15: 76,702,779 L273P probably damaging Het
Mical1 A G 10: 41,485,211 K757R possibly damaging Het
Myh9 A T 15: 77,777,813 V782D probably damaging Het
Nab2 C G 10: 127,665,047 E59Q probably damaging Het
Nfyc A T 4: 120,761,724 N244K probably damaging Het
Nupr1l A G 5: 129,908,831 I80M probably damaging Het
Olfr1229 T C 2: 89,283,057 I46M probably benign Het
Olfr583 A G 7: 103,051,369 T24A probably benign Het
Olfr76 A G 19: 12,120,332 C115R probably damaging Het
Pkn3 A G 2: 30,087,053 T602A probably benign Het
Prrc2b T A 2: 32,204,289 V561D probably benign Het
Psd2 T A 18: 36,005,790 V489E probably benign Het
Rasal2 T C 1: 157,230,059 T181A probably benign Het
Serpinb13 T C 1: 106,982,156 M1T probably null Het
Sgsm1 A T 5: 113,263,269 S864T possibly damaging Het
Slc5a10 C A 11: 61,673,941 G404V possibly damaging Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Son A G 16: 91,659,734 K1790E probably damaging Het
Syde2 A G 3: 146,002,421 probably benign Het
Tmem126a T C 7: 90,452,818 I58V probably benign Het
Vmn2r8 T C 5: 108,802,174 Y269C probably damaging Het
Yeats2 T A 16: 20,189,365 S416T probably damaging Het
Zfp40 A T 17: 23,175,869 H513Q probably damaging Het
Other mutations in Me1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Me1 APN 9 86598748 missense probably damaging 1.00
IGL01326:Me1 APN 9 86598718 critical splice donor site probably null
IGL02231:Me1 APN 9 86611855 missense possibly damaging 0.92
IGL02343:Me1 APN 9 86654641 critical splice donor site probably null
IGL02444:Me1 APN 9 86582914 splice site probably benign
IGL02655:Me1 APN 9 86654727 splice site probably benign
IGL03282:Me1 APN 9 86613596 missense probably damaging 0.99
R0116:Me1 UTSW 9 86654667 missense probably benign 0.01
R0270:Me1 UTSW 9 86596204 splice site probably benign
R0361:Me1 UTSW 9 86651002 missense probably damaging 1.00
R1601:Me1 UTSW 9 86678012 missense probably damaging 1.00
R1807:Me1 UTSW 9 86650879 missense probably damaging 0.98
R2085:Me1 UTSW 9 86613554 missense probably damaging 1.00
R2571:Me1 UTSW 9 86654698 missense probably damaging 1.00
R3012:Me1 UTSW 9 86611912 missense probably benign 0.00
R4649:Me1 UTSW 9 86679852 missense probably benign 0.00
R5540:Me1 UTSW 9 86679873 missense possibly damaging 0.60
R6129:Me1 UTSW 9 86650956 missense probably damaging 1.00
R6727:Me1 UTSW 9 86582798 missense possibly damaging 0.92
R7718:Me1 UTSW 9 86679900 missense probably damaging 1.00
R8329:Me1 UTSW 9 86619737 missense probably damaging 1.00
RF001:Me1 UTSW 9 86582823 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCTGTGAACTGTGGGAAGCC -3'
(R):5'- TGTGACTCCAGTGATTGCCATGAC -3'

Sequencing Primer
(F):5'- GGTTTACCCAAGTCCTAGCAGATG -3'
(R):5'- AGTGATTGCCATGACTCAGC -3'
Posted On2014-04-13