Incidental Mutation 'R1535:Idi1'
ID166911
Institutional Source Beutler Lab
Gene Symbol Idi1
Ensembl Gene ENSMUSG00000058258
Gene Nameisopentenyl-diphosphate delta isomerase
Synonyms
MMRRC Submission 039574-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1535 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location8885501-8892451 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 8886909 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000169314]
Predicted Effect probably benign
Transcript: ENSMUST00000169314
SMART Domains Protein: ENSMUSP00000132780
Gene: ENSMUSG00000058258

DomainStartEndE-ValueType
Pfam:NUDIX 106 256 1.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176851
Predicted Effect probably benign
Transcript: ENSMUST00000177397
Predicted Effect probably benign
Transcript: ENSMUST00000177400
Predicted Effect probably benign
Transcript: ENSMUST00000177447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221551
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IDI1 encodes a peroxisomally-localized enzyme that catalyzes the interconversion of isopentenyl diphosphate (IPP) to its highly electrophilic isomer, dimethylallyl diphosphate (DMAPP), which are the substrates for the successive reaction that results in the synthesis of farnesyl diphosphate and, ultimately, cholesterol. It has been shown in peroxisomal deficiency diseases such as Zellweger syndrome and neonatal adrenoleukodystrophy that there is reduction in IPP isomerase activity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C T 9: 50,764,007 R40Q probably damaging Het
3110009E18Rik T C 1: 120,171,473 S99P possibly damaging Het
4932431P20Rik C T 7: 29,529,579 noncoding transcript Het
Abca16 T A 7: 120,540,705 I1530N probably benign Het
Abcc9 T G 6: 142,664,635 Q601P probably damaging Het
Acap3 A G 4: 155,896,174 probably benign Het
Adamts16 A T 13: 70,791,794 probably null Het
Alpk2 G C 18: 65,350,204 S244R probably benign Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Bend5 C A 4: 111,459,763 D374E probably benign Het
Catsperg2 T C 7: 29,698,246 D1014G possibly damaging Het
Ccer2 G T 7: 28,757,397 G189* probably null Het
Ces2h A G 8: 105,014,486 T37A probably benign Het
Cmah T C 13: 24,439,220 F213L probably damaging Het
Cntn2 T C 1: 132,525,384 E390G probably benign Het
Coq7 C T 7: 118,529,674 R46Q possibly damaging Het
Cpb1 T A 3: 20,266,287 D136V probably benign Het
Cxcr2 T C 1: 74,159,058 L237P probably damaging Het
Daam1 T C 12: 71,951,918 L549P unknown Het
Diaph1 A G 18: 37,896,093 probably null Het
Dis3 G T 14: 99,079,426 Q825K probably damaging Het
Dnah11 C T 12: 118,018,730 R2568Q probably damaging Het
Dnah12 A T 14: 26,816,322 R2312S possibly damaging Het
Dock9 C T 14: 121,546,064 E2041K probably damaging Het
Doxl2 T C 6: 48,975,464 F108L probably damaging Het
Eci1 A G 17: 24,439,090 E282G probably benign Het
Egf T A 3: 129,690,778 T464S probably benign Het
Eif4g3 C T 4: 138,097,302 P97S probably damaging Het
Emsy A G 7: 98,593,737 V1065A possibly damaging Het
Ep400 G T 5: 110,708,166 probably benign Het
Fam13a A C 6: 58,939,347 I607S probably damaging Het
Fam241b A G 10: 62,108,949 S113P probably damaging Het
Fbxl21 A T 13: 56,523,527 M1L probably benign Het
Fnip2 C A 3: 79,481,765 C553F probably damaging Het
Frmd3 G T 4: 74,013,758 probably benign Het
Gm597 T C 1: 28,777,424 E509G probably damaging Het
Gm9745 A T 13: 8,940,644 probably benign Het
Grm4 G A 17: 27,434,801 S470L probably benign Het
Gucy2e T A 11: 69,226,244 I784F probably damaging Het
H1fx T C 6: 87,981,148 Y70C probably damaging Het
Hmcn2 A T 2: 31,420,407 T3338S possibly damaging Het
Idh1 C T 1: 65,168,538 G161R probably damaging Het
Kcnq2 C T 2: 181,134,825 G90S probably damaging Het
Klhl29 A G 12: 5,084,486 Y642H probably damaging Het
Lmtk3 T A 7: 45,794,570 probably benign Het
Macf1 A T 4: 123,440,693 F4420I probably benign Het
Me1 A G 9: 86,587,043 S470P probably damaging Het
Mfsd2b A G 12: 4,870,605 S71P probably damaging Het
Mfsd3 T C 15: 76,702,779 L273P probably damaging Het
Mical1 A G 10: 41,485,211 K757R possibly damaging Het
Myh9 A T 15: 77,777,813 V782D probably damaging Het
Nab2 C G 10: 127,665,047 E59Q probably damaging Het
Nfyc A T 4: 120,761,724 N244K probably damaging Het
Nupr1l A G 5: 129,908,831 I80M probably damaging Het
Olfr1229 T C 2: 89,283,057 I46M probably benign Het
Olfr583 A G 7: 103,051,369 T24A probably benign Het
Olfr76 A G 19: 12,120,332 C115R probably damaging Het
Pkn3 A G 2: 30,087,053 T602A probably benign Het
Prrc2b T A 2: 32,204,289 V561D probably benign Het
Psd2 T A 18: 36,005,790 V489E probably benign Het
Rasal2 T C 1: 157,230,059 T181A probably benign Het
Serpinb13 T C 1: 106,982,156 M1T probably null Het
Sgsm1 A T 5: 113,263,269 S864T possibly damaging Het
Slc5a10 C A 11: 61,673,941 G404V possibly damaging Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Son A G 16: 91,659,734 K1790E probably damaging Het
Syde2 A G 3: 146,002,421 probably benign Het
Tmem126a T C 7: 90,452,818 I58V probably benign Het
Vmn2r8 T C 5: 108,802,174 Y269C probably damaging Het
Yeats2 T A 16: 20,189,365 S416T probably damaging Het
Zfp40 A T 17: 23,175,869 H513Q probably damaging Het
Other mutations in Idi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01465:Idi1 APN 13 8890379 missense probably benign 0.12
R0304:Idi1 UTSW 13 8890357 missense probably damaging 1.00
R1739:Idi1 UTSW 13 8890411 missense probably benign 0.05
R3854:Idi1 UTSW 13 8885932 missense probably benign 0.05
R3855:Idi1 UTSW 13 8885932 missense probably benign 0.05
R3856:Idi1 UTSW 13 8885932 missense probably benign 0.05
R4463:Idi1 UTSW 13 8887472 splice site probably benign
R5049:Idi1 UTSW 13 8888042 missense probably damaging 1.00
R5081:Idi1 UTSW 13 8887927 nonsense probably null
R6062:Idi1 UTSW 13 8887505 missense probably damaging 1.00
R6082:Idi1 UTSW 13 8890470 nonsense probably null
R7261:Idi1 UTSW 13 8886895 missense probably benign 0.31
Z1177:Idi1 UTSW 13 8888019 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGATCAGACATTCTGTCACAATGCCTG -3'
(R):5'- GAACCCAGACCATTTGGTATCCTGC -3'

Sequencing Primer
(F):5'- GCCTGAAATAAATACCAGCCATCTTG -3'
(R):5'- TGGTATCCTGCtgtgtgtg -3'
Posted On2014-04-13