Incidental Mutation 'R1535:Eci1'
ID166926
Institutional Source Beutler Lab
Gene Symbol Eci1
Ensembl Gene ENSMUSG00000024132
Gene Nameenoyl-Coenzyme A delta isomerase 1
SynonymsDci, eci
MMRRC Submission 039574-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R1535 (G1)
Quality Score207
Status Validated
Chromosome17
Chromosomal Location24426683-24439316 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24439090 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 282 (E282G)
Ref Sequence ENSEMBL: ENSMUSP00000024946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024946] [ENSMUST00000056032] [ENSMUST00000088506] [ENSMUST00000119932] [ENSMUST00000148820] [ENSMUST00000154675] [ENSMUST00000226654] [ENSMUST00000226754] [ENSMUST00000226941]
Predicted Effect probably benign
Transcript: ENSMUST00000024946
AA Change: E282G

PolyPhen 2 Score 0.324 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000024946
Gene: ENSMUSG00000024132
AA Change: E282G

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Pfam:ECH_1 39 288 3.2e-96 PFAM
Pfam:ECH_2 44 289 5.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056032
SMART Domains Protein: ENSMUSP00000062344
Gene: ENSMUSG00000024137

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
ZnF_C2H2 57 82 3.95e1 SMART
low complexity region 84 99 N/A INTRINSIC
ZnF_C2H2 193 215 1.03e-2 SMART
ZnF_C2H2 221 243 7.37e-4 SMART
ZnF_C2H2 249 269 5.62e0 SMART
low complexity region 295 311 N/A INTRINSIC
ZnF_C2H2 433 455 5.9e-3 SMART
ZnF_C2H2 461 483 2.4e-3 SMART
ZnF_C2H2 489 511 2.49e-1 SMART
ZnF_C2H2 517 539 1.82e-3 SMART
ZnF_C2H2 545 567 1.56e-2 SMART
ZnF_C2H2 573 593 2.06e1 SMART
low complexity region 599 611 N/A INTRINSIC
low complexity region 642 661 N/A INTRINSIC
low complexity region 703 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088506
SMART Domains Protein: ENSMUSP00000085862
Gene: ENSMUSG00000024136

DomainStartEndE-ValueType
DNaseIc 5 276 4.18e-185 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119932
SMART Domains Protein: ENSMUSP00000113508
Gene: ENSMUSG00000024136

DomainStartEndE-ValueType
DNaseIc 5 276 4.18e-185 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129401
Predicted Effect probably benign
Transcript: ENSMUST00000148820
SMART Domains Protein: ENSMUSP00000119453
Gene: ENSMUSG00000024136

DomainStartEndE-ValueType
Blast:DNaseIc 5 60 2e-33 BLAST
PDB:4AWN|A 22 60 5e-8 PDB
SCOP:d2dnja_ 22 60 3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153858
Predicted Effect probably benign
Transcript: ENSMUST00000154675
SMART Domains Protein: ENSMUSP00000116743
Gene: ENSMUSG00000024136

DomainStartEndE-ValueType
DNaseIc 1 180 4.58e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226654
Predicted Effect probably benign
Transcript: ENSMUST00000226754
Predicted Effect probably benign
Transcript: ENSMUST00000226941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227241
Predicted Effect probably benign
Transcript: ENSMUST00000228882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227293
Meta Mutation Damage Score 0.3954 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hydratase/isomerase superfamily. The protein encoded is a key mitochondrial enzyme involved in beta-oxidation of unsaturated fatty acids. It catalyzes the transformation of 3-cis and 3-trans-enoyl-CoA esters arising during the stepwise degradation of cis-, mono-, and polyunsaturated fatty acids to the 2-trans-enoyl-CoA intermediates. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruption of this gene are normal until stressed. Starvation results in increased accumulation of triglycerides and unsaturated fatty acids in the liver and kidney. Secretion of fatty acid metabolites in the urine is greatly increased. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C T 9: 50,764,007 R40Q probably damaging Het
3110009E18Rik T C 1: 120,171,473 S99P possibly damaging Het
4932431P20Rik C T 7: 29,529,579 noncoding transcript Het
Abca16 T A 7: 120,540,705 I1530N probably benign Het
Abcc9 T G 6: 142,664,635 Q601P probably damaging Het
Acap3 A G 4: 155,896,174 probably benign Het
Adamts16 A T 13: 70,791,794 probably null Het
Alpk2 G C 18: 65,350,204 S244R probably benign Het
Atp8b1 C T 18: 64,545,264 V854M probably damaging Het
Bend5 C A 4: 111,459,763 D374E probably benign Het
Catsperg2 T C 7: 29,698,246 D1014G possibly damaging Het
Ccer2 G T 7: 28,757,397 G189* probably null Het
Ces2h A G 8: 105,014,486 T37A probably benign Het
Cmah T C 13: 24,439,220 F213L probably damaging Het
Cntn2 T C 1: 132,525,384 E390G probably benign Het
Coq7 C T 7: 118,529,674 R46Q possibly damaging Het
Cpb1 T A 3: 20,266,287 D136V probably benign Het
Cxcr2 T C 1: 74,159,058 L237P probably damaging Het
Daam1 T C 12: 71,951,918 L549P unknown Het
Diaph1 A G 18: 37,896,093 probably null Het
Dis3 G T 14: 99,079,426 Q825K probably damaging Het
Dnah11 C T 12: 118,018,730 R2568Q probably damaging Het
Dnah12 A T 14: 26,816,322 R2312S possibly damaging Het
Dock9 C T 14: 121,546,064 E2041K probably damaging Het
Doxl2 T C 6: 48,975,464 F108L probably damaging Het
Egf T A 3: 129,690,778 T464S probably benign Het
Eif4g3 C T 4: 138,097,302 P97S probably damaging Het
Emsy A G 7: 98,593,737 V1065A possibly damaging Het
Ep400 G T 5: 110,708,166 probably benign Het
Fam13a A C 6: 58,939,347 I607S probably damaging Het
Fam241b A G 10: 62,108,949 S113P probably damaging Het
Fbxl21 A T 13: 56,523,527 M1L probably benign Het
Fnip2 C A 3: 79,481,765 C553F probably damaging Het
Frmd3 G T 4: 74,013,758 probably benign Het
Gm597 T C 1: 28,777,424 E509G probably damaging Het
Gm9745 A T 13: 8,940,644 probably benign Het
Grm4 G A 17: 27,434,801 S470L probably benign Het
Gucy2e T A 11: 69,226,244 I784F probably damaging Het
H1fx T C 6: 87,981,148 Y70C probably damaging Het
Hmcn2 A T 2: 31,420,407 T3338S possibly damaging Het
Idh1 C T 1: 65,168,538 G161R probably damaging Het
Idi1 T C 13: 8,886,909 probably benign Het
Kcnq2 C T 2: 181,134,825 G90S probably damaging Het
Klhl29 A G 12: 5,084,486 Y642H probably damaging Het
Lmtk3 T A 7: 45,794,570 probably benign Het
Macf1 A T 4: 123,440,693 F4420I probably benign Het
Me1 A G 9: 86,587,043 S470P probably damaging Het
Mfsd2b A G 12: 4,870,605 S71P probably damaging Het
Mfsd3 T C 15: 76,702,779 L273P probably damaging Het
Mical1 A G 10: 41,485,211 K757R possibly damaging Het
Myh9 A T 15: 77,777,813 V782D probably damaging Het
Nab2 C G 10: 127,665,047 E59Q probably damaging Het
Nfyc A T 4: 120,761,724 N244K probably damaging Het
Nupr1l A G 5: 129,908,831 I80M probably damaging Het
Olfr1229 T C 2: 89,283,057 I46M probably benign Het
Olfr583 A G 7: 103,051,369 T24A probably benign Het
Olfr76 A G 19: 12,120,332 C115R probably damaging Het
Pkn3 A G 2: 30,087,053 T602A probably benign Het
Prrc2b T A 2: 32,204,289 V561D probably benign Het
Psd2 T A 18: 36,005,790 V489E probably benign Het
Rasal2 T C 1: 157,230,059 T181A probably benign Het
Serpinb13 T C 1: 106,982,156 M1T probably null Het
Sgsm1 A T 5: 113,263,269 S864T possibly damaging Het
Slc5a10 C A 11: 61,673,941 G404V possibly damaging Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Son A G 16: 91,659,734 K1790E probably damaging Het
Syde2 A G 3: 146,002,421 probably benign Het
Tmem126a T C 7: 90,452,818 I58V probably benign Het
Vmn2r8 T C 5: 108,802,174 Y269C probably damaging Het
Yeats2 T A 16: 20,189,365 S416T probably damaging Het
Zfp40 A T 17: 23,175,869 H513Q probably damaging Het
Other mutations in Eci1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03123:Eci1 APN 17 24436326 critical splice donor site probably null
R0391:Eci1 UTSW 17 24433260 splice site probably null
R1749:Eci1 UTSW 17 24426747 splice site probably null
R2286:Eci1 UTSW 17 24433229 missense probably damaging 0.99
R4179:Eci1 UTSW 17 24436277 missense probably damaging 1.00
R5656:Eci1 UTSW 17 24437309 missense probably damaging 1.00
R6508:Eci1 UTSW 17 24437309 missense probably damaging 1.00
R7062:Eci1 UTSW 17 24426740 unclassified probably benign
R7771:Eci1 UTSW 17 24433151 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCAAGTGTAGAGGAGCCGGGAAC -3'
(R):5'- CAGTGGGTCCCTAGAAGGCACATA -3'

Sequencing Primer
(F):5'- ACACTGCACAGGTGAGTTTC -3'
(R):5'- ATGTGGCAGCTGTAGGTTAG -3'
Posted On2014-04-13