Incidental Mutation 'R1535:Atp8b1'
ID166930
Institutional Source Beutler Lab
Gene Symbol Atp8b1
Ensembl Gene ENSMUSG00000039529
Gene NameATPase, class I, type 8B, member 1
SynonymsFIC1, Ic
MMRRC Submission 039574-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1535 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location64528979-64661000 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 64545264 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 854 (V854M)
Ref Sequence ENSEMBL: ENSMUSP00000025482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025482]
Predicted Effect probably damaging
Transcript: ENSMUST00000025482
AA Change: V854M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025482
Gene: ENSMUSG00000039529
AA Change: V854M

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 65 144 5.3e-29 PFAM
Pfam:E1-E2_ATPase 146 413 6e-11 PFAM
Pfam:HAD 451 902 2.4e-21 PFAM
Pfam:Cation_ATPase 532 632 1e-12 PFAM
Pfam:PhoLip_ATPase_C 919 1173 7.3e-82 PFAM
low complexity region 1193 1207 N/A INTRINSIC
low complexity region 1221 1232 N/A INTRINSIC
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.2%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P-type cation transport ATPase family, which belongs to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Mutations in this gene may result in progressive familial intrahepatic cholestasis type 1 and in benign recurrent intrahepatic cholestasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display abnormal bile salt homeostasis, normal bile secretion, and an impaired ability to handle increased bile salt loading resulting in liver damage and weight loss on a bile salt supplemented diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik C T 9: 50,764,007 R40Q probably damaging Het
3110009E18Rik T C 1: 120,171,473 S99P possibly damaging Het
4932431P20Rik C T 7: 29,529,579 noncoding transcript Het
Abca16 T A 7: 120,540,705 I1530N probably benign Het
Abcc9 T G 6: 142,664,635 Q601P probably damaging Het
Acap3 A G 4: 155,896,174 probably benign Het
Adamts16 A T 13: 70,791,794 probably null Het
Alpk2 G C 18: 65,350,204 S244R probably benign Het
Bend5 C A 4: 111,459,763 D374E probably benign Het
Catsperg2 T C 7: 29,698,246 D1014G possibly damaging Het
Ccer2 G T 7: 28,757,397 G189* probably null Het
Ces2h A G 8: 105,014,486 T37A probably benign Het
Cmah T C 13: 24,439,220 F213L probably damaging Het
Cntn2 T C 1: 132,525,384 E390G probably benign Het
Coq7 C T 7: 118,529,674 R46Q possibly damaging Het
Cpb1 T A 3: 20,266,287 D136V probably benign Het
Cxcr2 T C 1: 74,159,058 L237P probably damaging Het
Daam1 T C 12: 71,951,918 L549P unknown Het
Diaph1 A G 18: 37,896,093 probably null Het
Dis3 G T 14: 99,079,426 Q825K probably damaging Het
Dnah11 C T 12: 118,018,730 R2568Q probably damaging Het
Dnah12 A T 14: 26,816,322 R2312S possibly damaging Het
Dock9 C T 14: 121,546,064 E2041K probably damaging Het
Doxl2 T C 6: 48,975,464 F108L probably damaging Het
Eci1 A G 17: 24,439,090 E282G probably benign Het
Egf T A 3: 129,690,778 T464S probably benign Het
Eif4g3 C T 4: 138,097,302 P97S probably damaging Het
Emsy A G 7: 98,593,737 V1065A possibly damaging Het
Ep400 G T 5: 110,708,166 probably benign Het
Fam13a A C 6: 58,939,347 I607S probably damaging Het
Fam241b A G 10: 62,108,949 S113P probably damaging Het
Fbxl21 A T 13: 56,523,527 M1L probably benign Het
Fnip2 C A 3: 79,481,765 C553F probably damaging Het
Frmd3 G T 4: 74,013,758 probably benign Het
Gm597 T C 1: 28,777,424 E509G probably damaging Het
Gm9745 A T 13: 8,940,644 probably benign Het
Grm4 G A 17: 27,434,801 S470L probably benign Het
Gucy2e T A 11: 69,226,244 I784F probably damaging Het
H1fx T C 6: 87,981,148 Y70C probably damaging Het
Hmcn2 A T 2: 31,420,407 T3338S possibly damaging Het
Idh1 C T 1: 65,168,538 G161R probably damaging Het
Idi1 T C 13: 8,886,909 probably benign Het
Kcnq2 C T 2: 181,134,825 G90S probably damaging Het
Klhl29 A G 12: 5,084,486 Y642H probably damaging Het
Lmtk3 T A 7: 45,794,570 probably benign Het
Macf1 A T 4: 123,440,693 F4420I probably benign Het
Me1 A G 9: 86,587,043 S470P probably damaging Het
Mfsd2b A G 12: 4,870,605 S71P probably damaging Het
Mfsd3 T C 15: 76,702,779 L273P probably damaging Het
Mical1 A G 10: 41,485,211 K757R possibly damaging Het
Myh9 A T 15: 77,777,813 V782D probably damaging Het
Nab2 C G 10: 127,665,047 E59Q probably damaging Het
Nfyc A T 4: 120,761,724 N244K probably damaging Het
Nupr1l A G 5: 129,908,831 I80M probably damaging Het
Olfr1229 T C 2: 89,283,057 I46M probably benign Het
Olfr583 A G 7: 103,051,369 T24A probably benign Het
Olfr76 A G 19: 12,120,332 C115R probably damaging Het
Pkn3 A G 2: 30,087,053 T602A probably benign Het
Prrc2b T A 2: 32,204,289 V561D probably benign Het
Psd2 T A 18: 36,005,790 V489E probably benign Het
Rasal2 T C 1: 157,230,059 T181A probably benign Het
Serpinb13 T C 1: 106,982,156 M1T probably null Het
Sgsm1 A T 5: 113,263,269 S864T possibly damaging Het
Slc5a10 C A 11: 61,673,941 G404V possibly damaging Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Son A G 16: 91,659,734 K1790E probably damaging Het
Syde2 A G 3: 146,002,421 probably benign Het
Tmem126a T C 7: 90,452,818 I58V probably benign Het
Vmn2r8 T C 5: 108,802,174 Y269C probably damaging Het
Yeats2 T A 16: 20,189,365 S416T probably damaging Het
Zfp40 A T 17: 23,175,869 H513Q probably damaging Het
Other mutations in Atp8b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Atp8b1 APN 18 64564430 missense probably benign 0.23
IGL00907:Atp8b1 APN 18 64561705 missense possibly damaging 0.95
IGL00962:Atp8b1 APN 18 64531444 missense probably damaging 1.00
IGL01433:Atp8b1 APN 18 64573519 missense probably benign 0.00
IGL01525:Atp8b1 APN 18 64539252 nonsense probably null
IGL01645:Atp8b1 APN 18 64546113 missense probably benign 0.06
IGL02008:Atp8b1 APN 18 64538695 splice site probably benign
IGL02227:Atp8b1 APN 18 64562190 missense probably benign
IGL02231:Atp8b1 APN 18 64550384 missense possibly damaging 0.94
IGL02326:Atp8b1 APN 18 64538583 missense probably damaging 0.99
IGL02562:Atp8b1 APN 18 64581986 missense probably benign
IGL02929:Atp8b1 APN 18 64561662 missense possibly damaging 0.63
enchilada UTSW 18 64545989 critical splice donor site probably null
PIT4520001:Atp8b1 UTSW 18 64568180 missense probably benign 0.34
PIT4696001:Atp8b1 UTSW 18 64539270 missense possibly damaging 0.93
R0144:Atp8b1 UTSW 18 64571374 splice site probably benign
R0193:Atp8b1 UTSW 18 64561636 missense probably benign
R0277:Atp8b1 UTSW 18 64568252 missense possibly damaging 0.94
R0308:Atp8b1 UTSW 18 64545244 nonsense probably null
R0323:Atp8b1 UTSW 18 64568252 missense possibly damaging 0.94
R0403:Atp8b1 UTSW 18 64540310 missense probably damaging 1.00
R0601:Atp8b1 UTSW 18 64571653 splice site probably null
R0614:Atp8b1 UTSW 18 64533587 splice site probably benign
R0883:Atp8b1 UTSW 18 64564541 missense probably benign 0.44
R1077:Atp8b1 UTSW 18 64573262 nonsense probably null
R1292:Atp8b1 UTSW 18 64571021 missense probably damaging 0.99
R1494:Atp8b1 UTSW 18 64564526 missense probably damaging 1.00
R1522:Atp8b1 UTSW 18 64550432 missense probably benign 0.00
R1534:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1536:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1537:Atp8b1 UTSW 18 64545264 missense probably damaging 1.00
R1650:Atp8b1 UTSW 18 64571549 splice site probably benign
R1772:Atp8b1 UTSW 18 64573492 missense possibly damaging 0.88
R2016:Atp8b1 UTSW 18 64540334 missense probably damaging 1.00
R2017:Atp8b1 UTSW 18 64540334 missense probably damaging 1.00
R2043:Atp8b1 UTSW 18 64605200 missense possibly damaging 0.94
R2223:Atp8b1 UTSW 18 64564357 missense possibly damaging 0.88
R3052:Atp8b1 UTSW 18 64553108 missense probably benign 0.04
R3694:Atp8b1 UTSW 18 64533721 missense possibly damaging 0.81
R3738:Atp8b1 UTSW 18 64533729 splice site probably benign
R4211:Atp8b1 UTSW 18 64553047 missense probably damaging 1.00
R4362:Atp8b1 UTSW 18 64564537 missense probably damaging 1.00
R4560:Atp8b1 UTSW 18 64556879 nonsense probably null
R4560:Atp8b1 UTSW 18 64568247 missense probably benign 0.11
R4562:Atp8b1 UTSW 18 64556891 missense probably damaging 1.00
R4615:Atp8b1 UTSW 18 64553099 missense probably null
R4676:Atp8b1 UTSW 18 64538678 missense probably benign 0.01
R4738:Atp8b1 UTSW 18 64545180 missense probably benign 0.31
R4774:Atp8b1 UTSW 18 64533659 missense possibly damaging 0.49
R4808:Atp8b1 UTSW 18 64561711 missense probably benign 0.01
R4868:Atp8b1 UTSW 18 64551866 missense probably damaging 1.00
R5162:Atp8b1 UTSW 18 64561662 missense possibly damaging 0.63
R5289:Atp8b1 UTSW 18 64546087 missense possibly damaging 0.51
R5328:Atp8b1 UTSW 18 64531391 missense probably benign 0.00
R5400:Atp8b1 UTSW 18 64545989 critical splice donor site probably null
R5587:Atp8b1 UTSW 18 64539210 missense probably damaging 1.00
R5623:Atp8b1 UTSW 18 64546094 missense possibly damaging 0.85
R5651:Atp8b1 UTSW 18 64531382 missense probably benign 0.31
R5652:Atp8b1 UTSW 18 64531382 missense probably benign 0.31
R5653:Atp8b1 UTSW 18 64545197 missense probably damaging 1.00
R5667:Atp8b1 UTSW 18 64581923 missense probably damaging 1.00
R5689:Atp8b1 UTSW 18 64564537 missense probably damaging 1.00
R6008:Atp8b1 UTSW 18 64577616 missense probably damaging 1.00
R6315:Atp8b1 UTSW 18 64531479 missense probably damaging 0.97
R6759:Atp8b1 UTSW 18 64546090 missense probably benign 0.00
R6850:Atp8b1 UTSW 18 64556852 missense possibly damaging 0.94
R7255:Atp8b1 UTSW 18 64556868 missense probably damaging 1.00
X0025:Atp8b1 UTSW 18 64571405 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTATGATGCCTCAGTCCTGGCAAC -3'
(R):5'- CCCTCTGCTGTCACAGAATGAAATCC -3'

Sequencing Primer
(F):5'- TTCAGCAAGCTGGTGTCAC -3'
(R):5'- GAAGCTGAAGTTCCCAAGGA -3'
Posted On2014-04-13