Incidental Mutation 'R1521:Phlpp1'
ID 166937
Institutional Source Beutler Lab
Gene Symbol Phlpp1
Ensembl Gene ENSMUSG00000044340
Gene Name PH domain and leucine rich repeat protein phosphatase 1
Synonyms Plekhe1, Phlpp
MMRRC Submission 040870-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.118) question?
Stock # R1521 (G1)
Quality Score 166
Status Not validated
Chromosome 1
Chromosomal Location 106099599-106321975 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106320049 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1348 (V1348A)
Ref Sequence ENSEMBL: ENSMUSP00000056530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061047]
AlphaFold Q8CHE4
Predicted Effect probably damaging
Transcript: ENSMUST00000061047
AA Change: V1348A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056530
Gene: ENSMUSG00000044340
AA Change: V1348A

DomainStartEndE-ValueType
low complexity region 3 9 N/A INTRINSIC
low complexity region 21 27 N/A INTRINSIC
low complexity region 35 96 N/A INTRINSIC
low complexity region 97 143 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 227 235 N/A INTRINSIC
low complexity region 257 277 N/A INTRINSIC
low complexity region 299 313 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
low complexity region 355 369 N/A INTRINSIC
PH 493 594 3.16e-2 SMART
LRR 615 634 4.75e2 SMART
LRR 648 669 7.16e0 SMART
LRR 669 688 1.48e1 SMART
LRR 692 714 2.14e1 SMART
LRR 715 738 1.37e1 SMART
LRR 786 809 3.27e1 SMART
LRR 849 868 8.11e0 SMART
LRR 872 895 1.97e1 SMART
LRR 895 914 2.55e1 SMART
LRR 919 940 1.86e1 SMART
LRR 941 960 1.67e1 SMART
LRR 991 1010 2.13e1 SMART
LRR 1015 1038 5.11e0 SMART
PP2Cc 1121 1376 2.62e-58 SMART
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1424 1445 N/A INTRINSIC
Blast:PP2Cc 1463 1555 2e-39 BLAST
low complexity region 1608 1624 N/A INTRINSIC
low complexity region 1640 1671 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine phosphatase family. The encoded protein promotes apoptosis by dephosphorylating and inactivating the serine/threonine kinase Akt, and functions as a tumor suppressor in multiple types of cancer. Increased expression of this gene may also play a role in obesity and type 2 diabetes by interfering with Akt-mediated insulin signaling. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null mutation display impairment in the ability to stabilize the circadian period after light induced resetting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 112,713,867 (GRCm39) L104P possibly damaging Het
Adgrf5 T C 17: 43,741,443 (GRCm39) V360A probably benign Het
Ahnak G A 19: 8,982,092 (GRCm39) M1125I probably benign Het
Akap12 T C 10: 4,304,804 (GRCm39) V538A probably benign Het
Arhgef10l T C 4: 140,242,749 (GRCm39) D1088G possibly damaging Het
Atp7b A T 8: 22,517,689 (GRCm39) L268Q probably damaging Het
Atxn2 A C 5: 121,917,654 (GRCm39) N516T probably damaging Het
Cacna1h T C 17: 25,616,328 (GRCm39) M184V possibly damaging Het
Cacnb2 G T 2: 14,619,163 (GRCm39) R66L probably benign Het
Casp8ap2 A G 4: 32,631,867 (GRCm39) E96G probably damaging Het
Ccdc78 G T 17: 26,007,755 (GRCm39) R264L probably damaging Het
Cdh4 G A 2: 179,439,351 (GRCm39) R166H probably damaging Het
Cog7 C T 7: 121,529,797 (GRCm39) D615N possibly damaging Het
Crtc2 T C 3: 90,164,690 (GRCm39) V115A probably benign Het
Crybg1 A G 10: 43,874,412 (GRCm39) S899P probably damaging Het
Ctdnep1 T A 11: 69,879,461 (GRCm39) V128E probably damaging Het
Ctnna3 A G 10: 64,795,621 (GRCm39) K780E probably benign Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dazap2 T A 15: 100,515,946 (GRCm39) Y91* probably null Het
Dcdc5 T C 2: 106,182,014 (GRCm39) noncoding transcript Het
Dppa1 T A 11: 46,501,300 (GRCm39) R74S possibly damaging Het
Elovl1 A T 4: 118,289,197 (GRCm39) T241S probably benign Het
Eya1 G T 1: 14,344,774 (GRCm39) Q86K probably damaging Het
Fam110d T C 4: 133,978,661 (GRCm39) *272W probably null Het
Fancm A T 12: 65,168,478 (GRCm39) M1614L probably benign Het
Fcgbp C T 7: 27,774,585 (GRCm39) T53I probably benign Het
Fpr3 T A 17: 18,191,277 (GRCm39) W183R probably damaging Het
Galnt13 G A 2: 54,744,657 (GRCm39) V119I probably benign Het
Garin4 T A 1: 190,896,219 (GRCm39) R141S probably benign Het
Gcfc2 T C 6: 81,900,793 (GRCm39) S36P probably benign Het
Gdap2 T A 3: 100,101,931 (GRCm39) D412E possibly damaging Het
Gm12258 T C 11: 58,750,381 (GRCm39) C41R probably damaging Het
Hipk1 T G 3: 103,685,098 (GRCm39) E172D probably benign Het
Hmgcs1 T G 13: 120,165,127 (GRCm39) L326R probably benign Het
Hs6st1 C A 1: 36,107,967 (GRCm39) R77S probably damaging Het
Ifit3 A T 19: 34,564,573 (GRCm39) N40Y probably damaging Het
Il1a T A 2: 129,146,661 (GRCm39) Q144L possibly damaging Het
Itga7 A G 10: 128,793,680 (GRCm39) E1128G possibly damaging Het
Itih2 T C 2: 10,111,558 (GRCm39) D460G probably damaging Het
Ivns1abp G A 1: 151,227,309 (GRCm39) C39Y probably damaging Het
Kif22 G T 7: 126,627,011 (GRCm39) A646E probably damaging Het
Klhl29 T C 12: 5,141,307 (GRCm39) Y559C probably damaging Het
Klhl7 T A 5: 24,354,108 (GRCm39) probably null Het
Klhl9 A G 4: 88,640,230 (GRCm39) S4P probably benign Het
Klk10 A G 7: 43,432,304 (GRCm39) Q79R probably benign Het
Klk6 T C 7: 43,478,699 (GRCm39) probably null Het
Kpna2rt T A 17: 90,217,734 (GRCm39) N4I possibly damaging Het
Lamc2 C T 1: 153,042,009 (GRCm39) E42K probably benign Het
Lingo3 T C 10: 80,671,555 (GRCm39) D125G probably benign Het
Map1b T C 13: 99,569,247 (GRCm39) N1158S unknown Het
Masp1 T A 16: 23,313,387 (GRCm39) N183Y probably damaging Het
Mdga2 A G 12: 66,615,700 (GRCm39) Y636H probably benign Het
Mical2 T A 7: 111,980,817 (GRCm39) S264T probably damaging Het
Mif A G 10: 75,695,375 (GRCm39) V95A possibly damaging Het
Mmp17 G A 5: 129,672,152 (GRCm39) probably null Het
Mmp23 T C 4: 155,735,174 (GRCm39) R390G possibly damaging Het
Ncoa6 A C 2: 155,257,142 (GRCm39) S800R possibly damaging Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Nr2e3 A T 9: 59,856,488 (GRCm39) S67R probably damaging Het
Odf2l T C 3: 144,854,797 (GRCm39) S545P possibly damaging Het
Or10d3 A T 9: 39,462,080 (GRCm39) V29E possibly damaging Het
Or4a47 G A 2: 89,665,516 (GRCm39) R258* probably null Het
Or52s1b T A 7: 102,822,658 (GRCm39) Y62F probably benign Het
Or5k1b C T 16: 58,581,216 (GRCm39) E108K probably damaging Het
Or7e176 A C 9: 20,171,728 (GRCm39) Q197H possibly damaging Het
Or7g27 C T 9: 19,249,948 (GRCm39) S64F probably benign Het
Or8b51 T G 9: 38,569,014 (GRCm39) I225L probably damaging Het
Otog A T 7: 45,908,688 (GRCm39) H562L possibly damaging Het
Pcdh15 T C 10: 74,430,023 (GRCm39) V1250A probably damaging Het
Pde1c A G 6: 56,150,592 (GRCm39) V309A possibly damaging Het
Pfkfb4 A C 9: 108,836,373 (GRCm39) T134P probably damaging Het
Phc3 G T 3: 30,990,724 (GRCm39) Q498K possibly damaging Het
Pik3ap1 T C 19: 41,309,997 (GRCm39) D441G probably damaging Het
Pkd1l2 T C 8: 117,792,239 (GRCm39) probably null Het
Pla2g4a T C 1: 149,733,437 (GRCm39) probably null Het
Pola2 A T 19: 5,998,434 (GRCm39) I376N probably damaging Het
Pold2 T A 11: 5,826,833 (GRCm39) N34Y probably damaging Het
Ppp2r5c T C 12: 110,521,320 (GRCm39) L281P probably damaging Het
Prss46 A G 9: 110,678,703 (GRCm39) I29V probably benign Het
Ranbp6 A T 19: 29,788,846 (GRCm39) V502E probably benign Het
Rdh14 T C 12: 10,444,613 (GRCm39) F155L probably damaging Het
Rnaseh2a A T 8: 85,692,487 (GRCm39) probably null Het
Rpp30 A G 19: 36,071,785 (GRCm39) T118A possibly damaging Het
Rragd T C 4: 32,996,005 (GRCm39) F117L probably damaging Het
Rxylt1 A G 10: 121,926,384 (GRCm39) W243R probably damaging Het
S100a2 T A 3: 90,498,599 (GRCm39) probably null Het
Septin12 T C 16: 4,814,340 (GRCm39) K43R probably damaging Het
Sh3tc2 A G 18: 62,141,559 (GRCm39) E1080G probably damaging Het
Slc26a9 A G 1: 131,678,415 (GRCm39) K27R probably damaging Het
Spata17 T A 1: 186,926,191 (GRCm39) K46N probably damaging Het
St14 A C 9: 31,019,511 (GRCm39) D103E probably benign Het
St6galnac2 T A 11: 116,575,173 (GRCm39) Q222L possibly damaging Het
Tdrd9 T C 12: 112,002,844 (GRCm39) V831A probably damaging Het
Tert A G 13: 73,790,175 (GRCm39) E843G probably damaging Het
Tex21 A G 12: 76,251,044 (GRCm39) V464A probably benign Het
Tmem232 T A 17: 65,791,496 (GRCm39) H124L probably damaging Het
Tnfrsf19 T G 14: 61,242,555 (GRCm39) S110R probably damaging Het
Tnnt3 A T 7: 142,069,562 (GRCm39) K272* probably null Het
Tnxb T C 17: 34,930,477 (GRCm39) L2054P probably damaging Het
Trcg1 A C 9: 57,149,748 (GRCm39) D440A probably benign Het
Trpm3 A G 19: 22,878,585 (GRCm39) E504G probably damaging Het
Trpm5 C T 7: 142,636,626 (GRCm39) R437H probably benign Het
Ttn T C 2: 76,571,511 (GRCm39) R18134G probably damaging Het
Uchl5 A C 1: 143,674,160 (GRCm39) M64L possibly damaging Het
Urb1 G A 16: 90,550,751 (GRCm39) R2034W probably damaging Het
Usp44 T A 10: 93,683,048 (GRCm39) C452* probably null Het
Uvssa G A 5: 33,571,278 (GRCm39) A641T probably damaging Het
Vmn1r204 T A 13: 22,741,248 (GRCm39) I293N probably benign Het
Vmn2r84 A T 10: 130,225,137 (GRCm39) C458S probably benign Het
Vmn2r85 T G 10: 130,261,788 (GRCm39) H183P probably damaging Het
Vps13d G T 4: 144,832,431 (GRCm39) T2825K probably benign Het
Zc3hc1 T A 6: 30,376,024 (GRCm39) I179F probably benign Het
Zfp112 A G 7: 23,825,210 (GRCm39) N393D probably damaging Het
Zfp558 A G 9: 18,367,859 (GRCm39) S310P possibly damaging Het
Zfp560 A C 9: 20,260,071 (GRCm39) probably null Het
Zfp668 C T 7: 127,466,252 (GRCm39) E311K probably benign Het
Zfp763 T A 17: 33,252,276 (GRCm39) M1L probably benign Het
Zfp947 A T 17: 22,364,813 (GRCm39) M287K probably benign Het
Other mutations in Phlpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Phlpp1 APN 1 106,267,178 (GRCm39) missense probably damaging 1.00
IGL00848:Phlpp1 APN 1 106,303,985 (GRCm39) missense probably damaging 1.00
IGL01122:Phlpp1 APN 1 106,101,166 (GRCm39) missense possibly damaging 0.51
IGL01588:Phlpp1 APN 1 106,308,119 (GRCm39) missense probably damaging 1.00
IGL02145:Phlpp1 APN 1 106,317,613 (GRCm39) missense probably damaging 0.96
IGL02417:Phlpp1 APN 1 106,320,444 (GRCm39) missense probably benign 0.00
IGL02863:Phlpp1 APN 1 106,304,027 (GRCm39) splice site probably null
IGL03178:Phlpp1 APN 1 106,320,118 (GRCm39) missense probably damaging 0.99
R0400:Phlpp1 UTSW 1 106,320,664 (GRCm39) missense probably benign 0.35
R0423:Phlpp1 UTSW 1 106,267,345 (GRCm39) missense probably benign 0.03
R0449:Phlpp1 UTSW 1 106,278,308 (GRCm39) missense probably damaging 0.98
R0765:Phlpp1 UTSW 1 106,320,013 (GRCm39) missense probably damaging 1.00
R0884:Phlpp1 UTSW 1 106,317,395 (GRCm39) splice site probably null
R1394:Phlpp1 UTSW 1 106,278,348 (GRCm39) missense possibly damaging 0.82
R1395:Phlpp1 UTSW 1 106,278,348 (GRCm39) missense possibly damaging 0.82
R1428:Phlpp1 UTSW 1 106,308,155 (GRCm39) splice site probably null
R1438:Phlpp1 UTSW 1 106,101,142 (GRCm39) missense possibly damaging 0.53
R1572:Phlpp1 UTSW 1 106,320,519 (GRCm39) missense probably damaging 1.00
R1588:Phlpp1 UTSW 1 106,308,115 (GRCm39) missense probably damaging 1.00
R1843:Phlpp1 UTSW 1 106,271,235 (GRCm39) missense probably benign 0.40
R1889:Phlpp1 UTSW 1 106,246,580 (GRCm39) missense possibly damaging 0.95
R2404:Phlpp1 UTSW 1 106,100,569 (GRCm39) missense probably benign 0.22
R2942:Phlpp1 UTSW 1 106,100,502 (GRCm39) missense probably benign 0.00
R3774:Phlpp1 UTSW 1 106,320,921 (GRCm39) small deletion probably benign
R3832:Phlpp1 UTSW 1 106,320,327 (GRCm39) missense probably damaging 1.00
R4029:Phlpp1 UTSW 1 106,320,279 (GRCm39) missense probably damaging 0.98
R4086:Phlpp1 UTSW 1 106,274,891 (GRCm39) missense probably benign 0.03
R4112:Phlpp1 UTSW 1 106,292,068 (GRCm39) missense probably damaging 1.00
R4472:Phlpp1 UTSW 1 106,314,176 (GRCm39) missense probably damaging 1.00
R4654:Phlpp1 UTSW 1 106,267,231 (GRCm39) missense probably benign 0.00
R4908:Phlpp1 UTSW 1 106,317,481 (GRCm39) missense probably damaging 1.00
R5027:Phlpp1 UTSW 1 106,209,201 (GRCm39) missense probably damaging 1.00
R5199:Phlpp1 UTSW 1 106,101,124 (GRCm39) missense probably damaging 0.98
R5352:Phlpp1 UTSW 1 106,100,455 (GRCm39) missense probably benign 0.07
R5508:Phlpp1 UTSW 1 106,292,120 (GRCm39) missense probably benign 0.02
R5570:Phlpp1 UTSW 1 106,101,162 (GRCm39) missense probably benign 0.01
R5590:Phlpp1 UTSW 1 106,320,657 (GRCm39) missense possibly damaging 0.95
R5838:Phlpp1 UTSW 1 106,274,862 (GRCm39) nonsense probably null
R5955:Phlpp1 UTSW 1 106,291,960 (GRCm39) splice site probably null
R5992:Phlpp1 UTSW 1 106,246,723 (GRCm39) nonsense probably null
R6469:Phlpp1 UTSW 1 106,214,833 (GRCm39) missense probably damaging 1.00
R6821:Phlpp1 UTSW 1 106,314,174 (GRCm39) missense probably damaging 0.98
R6952:Phlpp1 UTSW 1 106,100,209 (GRCm39) missense probably benign 0.04
R7101:Phlpp1 UTSW 1 106,100,397 (GRCm39) missense possibly damaging 0.96
R7402:Phlpp1 UTSW 1 106,317,420 (GRCm39) missense probably damaging 1.00
R7425:Phlpp1 UTSW 1 106,320,303 (GRCm39) missense probably benign 0.00
R7692:Phlpp1 UTSW 1 106,209,132 (GRCm39) missense probably damaging 1.00
R7874:Phlpp1 UTSW 1 106,317,603 (GRCm39) missense probably benign 0.05
R7970:Phlpp1 UTSW 1 106,101,015 (GRCm39) missense probably damaging 1.00
R8080:Phlpp1 UTSW 1 106,320,706 (GRCm39) missense probably benign 0.00
R8133:Phlpp1 UTSW 1 106,100,522 (GRCm39) frame shift probably null
R8224:Phlpp1 UTSW 1 106,320,348 (GRCm39) missense probably damaging 1.00
R8503:Phlpp1 UTSW 1 106,320,019 (GRCm39) missense probably benign 0.00
R8830:Phlpp1 UTSW 1 106,278,333 (GRCm39) missense probably damaging 1.00
R8882:Phlpp1 UTSW 1 106,320,372 (GRCm39) missense probably benign 0.01
R9257:Phlpp1 UTSW 1 106,100,281 (GRCm39) missense possibly damaging 0.85
R9472:Phlpp1 UTSW 1 106,308,079 (GRCm39) missense probably damaging 0.99
R9691:Phlpp1 UTSW 1 106,246,699 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCAATGGAGTGACAGAGTCCACG -3'
(R):5'- ATCTCAGATGCCATGCCACTGC -3'

Sequencing Primer
(F):5'- AGAGTCCACGCGCATCC -3'
(R):5'- CCTTGATGACCATGTTGACGG -3'
Posted On 2014-04-13