Incidental Mutation 'R1521:Odf2l'
ID 166960
Institutional Source Beutler Lab
Gene Symbol Odf2l
Ensembl Gene ENSMUSG00000028256
Gene Name outer dense fiber of sperm tails 2-like
Synonyms 4733401D09Rik, 9630045K08Rik
MMRRC Submission 040870-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.166) question?
Stock # R1521 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 144824349-144859676 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144854797 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 545 (S545P)
Ref Sequence ENSEMBL: ENSMUSP00000096140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029920] [ENSMUST00000098538] [ENSMUST00000098539] [ENSMUST00000106192] [ENSMUST00000200353]
AlphaFold Q9D478
Predicted Effect possibly damaging
Transcript: ENSMUST00000029920
AA Change: S449P

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029920
Gene: ENSMUSG00000028256
AA Change: S449P

DomainStartEndE-ValueType
coiled coil region 31 58 N/A INTRINSIC
coiled coil region 85 183 N/A INTRINSIC
coiled coil region 206 367 N/A INTRINSIC
coiled coil region 388 508 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098538
AA Change: S545P

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096140
Gene: ENSMUSG00000028256
AA Change: S545P

DomainStartEndE-ValueType
coiled coil region 31 58 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
coiled coil region 128 226 N/A INTRINSIC
coiled coil region 249 604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098539
AA Change: S492P

PolyPhen 2 Score 0.422 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096141
Gene: ENSMUSG00000028256
AA Change: S492P

DomainStartEndE-ValueType
coiled coil region 31 58 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
coiled coil region 128 226 N/A INTRINSIC
coiled coil region 249 410 N/A INTRINSIC
coiled coil region 431 551 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106192
AA Change: S492P

PolyPhen 2 Score 0.422 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101798
Gene: ENSMUSG00000028256
AA Change: S492P

DomainStartEndE-ValueType
coiled coil region 31 58 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
coiled coil region 128 226 N/A INTRINSIC
coiled coil region 249 410 N/A INTRINSIC
coiled coil region 431 551 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196426
Predicted Effect probably benign
Transcript: ENSMUST00000198764
Predicted Effect unknown
Transcript: ENSMUST00000200353
AA Change: S7P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198808
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 112,713,867 (GRCm39) L104P possibly damaging Het
Adgrf5 T C 17: 43,741,443 (GRCm39) V360A probably benign Het
Ahnak G A 19: 8,982,092 (GRCm39) M1125I probably benign Het
Akap12 T C 10: 4,304,804 (GRCm39) V538A probably benign Het
Arhgef10l T C 4: 140,242,749 (GRCm39) D1088G possibly damaging Het
Atp7b A T 8: 22,517,689 (GRCm39) L268Q probably damaging Het
Atxn2 A C 5: 121,917,654 (GRCm39) N516T probably damaging Het
Cacna1h T C 17: 25,616,328 (GRCm39) M184V possibly damaging Het
Cacnb2 G T 2: 14,619,163 (GRCm39) R66L probably benign Het
Casp8ap2 A G 4: 32,631,867 (GRCm39) E96G probably damaging Het
Ccdc78 G T 17: 26,007,755 (GRCm39) R264L probably damaging Het
Cdh4 G A 2: 179,439,351 (GRCm39) R166H probably damaging Het
Cog7 C T 7: 121,529,797 (GRCm39) D615N possibly damaging Het
Crtc2 T C 3: 90,164,690 (GRCm39) V115A probably benign Het
Crybg1 A G 10: 43,874,412 (GRCm39) S899P probably damaging Het
Ctdnep1 T A 11: 69,879,461 (GRCm39) V128E probably damaging Het
Ctnna3 A G 10: 64,795,621 (GRCm39) K780E probably benign Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dazap2 T A 15: 100,515,946 (GRCm39) Y91* probably null Het
Dcdc5 T C 2: 106,182,014 (GRCm39) noncoding transcript Het
Dppa1 T A 11: 46,501,300 (GRCm39) R74S possibly damaging Het
Elovl1 A T 4: 118,289,197 (GRCm39) T241S probably benign Het
Eya1 G T 1: 14,344,774 (GRCm39) Q86K probably damaging Het
Fam110d T C 4: 133,978,661 (GRCm39) *272W probably null Het
Fancm A T 12: 65,168,478 (GRCm39) M1614L probably benign Het
Fcgbp C T 7: 27,774,585 (GRCm39) T53I probably benign Het
Fpr3 T A 17: 18,191,277 (GRCm39) W183R probably damaging Het
Galnt13 G A 2: 54,744,657 (GRCm39) V119I probably benign Het
Garin4 T A 1: 190,896,219 (GRCm39) R141S probably benign Het
Gcfc2 T C 6: 81,900,793 (GRCm39) S36P probably benign Het
Gdap2 T A 3: 100,101,931 (GRCm39) D412E possibly damaging Het
Gm12258 T C 11: 58,750,381 (GRCm39) C41R probably damaging Het
Hipk1 T G 3: 103,685,098 (GRCm39) E172D probably benign Het
Hmgcs1 T G 13: 120,165,127 (GRCm39) L326R probably benign Het
Hs6st1 C A 1: 36,107,967 (GRCm39) R77S probably damaging Het
Ifit3 A T 19: 34,564,573 (GRCm39) N40Y probably damaging Het
Il1a T A 2: 129,146,661 (GRCm39) Q144L possibly damaging Het
Itga7 A G 10: 128,793,680 (GRCm39) E1128G possibly damaging Het
Itih2 T C 2: 10,111,558 (GRCm39) D460G probably damaging Het
Ivns1abp G A 1: 151,227,309 (GRCm39) C39Y probably damaging Het
Kif22 G T 7: 126,627,011 (GRCm39) A646E probably damaging Het
Klhl29 T C 12: 5,141,307 (GRCm39) Y559C probably damaging Het
Klhl7 T A 5: 24,354,108 (GRCm39) probably null Het
Klhl9 A G 4: 88,640,230 (GRCm39) S4P probably benign Het
Klk10 A G 7: 43,432,304 (GRCm39) Q79R probably benign Het
Klk6 T C 7: 43,478,699 (GRCm39) probably null Het
Kpna2rt T A 17: 90,217,734 (GRCm39) N4I possibly damaging Het
Lamc2 C T 1: 153,042,009 (GRCm39) E42K probably benign Het
Lingo3 T C 10: 80,671,555 (GRCm39) D125G probably benign Het
Map1b T C 13: 99,569,247 (GRCm39) N1158S unknown Het
Masp1 T A 16: 23,313,387 (GRCm39) N183Y probably damaging Het
Mdga2 A G 12: 66,615,700 (GRCm39) Y636H probably benign Het
Mical2 T A 7: 111,980,817 (GRCm39) S264T probably damaging Het
Mif A G 10: 75,695,375 (GRCm39) V95A possibly damaging Het
Mmp17 G A 5: 129,672,152 (GRCm39) probably null Het
Mmp23 T C 4: 155,735,174 (GRCm39) R390G possibly damaging Het
Ncoa6 A C 2: 155,257,142 (GRCm39) S800R possibly damaging Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Nr2e3 A T 9: 59,856,488 (GRCm39) S67R probably damaging Het
Or10d3 A T 9: 39,462,080 (GRCm39) V29E possibly damaging Het
Or4a47 G A 2: 89,665,516 (GRCm39) R258* probably null Het
Or52s1b T A 7: 102,822,658 (GRCm39) Y62F probably benign Het
Or5k1b C T 16: 58,581,216 (GRCm39) E108K probably damaging Het
Or7e176 A C 9: 20,171,728 (GRCm39) Q197H possibly damaging Het
Or7g27 C T 9: 19,249,948 (GRCm39) S64F probably benign Het
Or8b51 T G 9: 38,569,014 (GRCm39) I225L probably damaging Het
Otog A T 7: 45,908,688 (GRCm39) H562L possibly damaging Het
Pcdh15 T C 10: 74,430,023 (GRCm39) V1250A probably damaging Het
Pde1c A G 6: 56,150,592 (GRCm39) V309A possibly damaging Het
Pfkfb4 A C 9: 108,836,373 (GRCm39) T134P probably damaging Het
Phc3 G T 3: 30,990,724 (GRCm39) Q498K possibly damaging Het
Phlpp1 T C 1: 106,320,049 (GRCm39) V1348A probably damaging Het
Pik3ap1 T C 19: 41,309,997 (GRCm39) D441G probably damaging Het
Pkd1l2 T C 8: 117,792,239 (GRCm39) probably null Het
Pla2g4a T C 1: 149,733,437 (GRCm39) probably null Het
Pola2 A T 19: 5,998,434 (GRCm39) I376N probably damaging Het
Pold2 T A 11: 5,826,833 (GRCm39) N34Y probably damaging Het
Ppp2r5c T C 12: 110,521,320 (GRCm39) L281P probably damaging Het
Prss46 A G 9: 110,678,703 (GRCm39) I29V probably benign Het
Ranbp6 A T 19: 29,788,846 (GRCm39) V502E probably benign Het
Rdh14 T C 12: 10,444,613 (GRCm39) F155L probably damaging Het
Rnaseh2a A T 8: 85,692,487 (GRCm39) probably null Het
Rpp30 A G 19: 36,071,785 (GRCm39) T118A possibly damaging Het
Rragd T C 4: 32,996,005 (GRCm39) F117L probably damaging Het
Rxylt1 A G 10: 121,926,384 (GRCm39) W243R probably damaging Het
S100a2 T A 3: 90,498,599 (GRCm39) probably null Het
Septin12 T C 16: 4,814,340 (GRCm39) K43R probably damaging Het
Sh3tc2 A G 18: 62,141,559 (GRCm39) E1080G probably damaging Het
Slc26a9 A G 1: 131,678,415 (GRCm39) K27R probably damaging Het
Spata17 T A 1: 186,926,191 (GRCm39) K46N probably damaging Het
St14 A C 9: 31,019,511 (GRCm39) D103E probably benign Het
St6galnac2 T A 11: 116,575,173 (GRCm39) Q222L possibly damaging Het
Tdrd9 T C 12: 112,002,844 (GRCm39) V831A probably damaging Het
Tert A G 13: 73,790,175 (GRCm39) E843G probably damaging Het
Tex21 A G 12: 76,251,044 (GRCm39) V464A probably benign Het
Tmem232 T A 17: 65,791,496 (GRCm39) H124L probably damaging Het
Tnfrsf19 T G 14: 61,242,555 (GRCm39) S110R probably damaging Het
Tnnt3 A T 7: 142,069,562 (GRCm39) K272* probably null Het
Tnxb T C 17: 34,930,477 (GRCm39) L2054P probably damaging Het
Trcg1 A C 9: 57,149,748 (GRCm39) D440A probably benign Het
Trpm3 A G 19: 22,878,585 (GRCm39) E504G probably damaging Het
Trpm5 C T 7: 142,636,626 (GRCm39) R437H probably benign Het
Ttn T C 2: 76,571,511 (GRCm39) R18134G probably damaging Het
Uchl5 A C 1: 143,674,160 (GRCm39) M64L possibly damaging Het
Urb1 G A 16: 90,550,751 (GRCm39) R2034W probably damaging Het
Usp44 T A 10: 93,683,048 (GRCm39) C452* probably null Het
Uvssa G A 5: 33,571,278 (GRCm39) A641T probably damaging Het
Vmn1r204 T A 13: 22,741,248 (GRCm39) I293N probably benign Het
Vmn2r84 A T 10: 130,225,137 (GRCm39) C458S probably benign Het
Vmn2r85 T G 10: 130,261,788 (GRCm39) H183P probably damaging Het
Vps13d G T 4: 144,832,431 (GRCm39) T2825K probably benign Het
Zc3hc1 T A 6: 30,376,024 (GRCm39) I179F probably benign Het
Zfp112 A G 7: 23,825,210 (GRCm39) N393D probably damaging Het
Zfp558 A G 9: 18,367,859 (GRCm39) S310P possibly damaging Het
Zfp560 A C 9: 20,260,071 (GRCm39) probably null Het
Zfp668 C T 7: 127,466,252 (GRCm39) E311K probably benign Het
Zfp763 T A 17: 33,252,276 (GRCm39) M1L probably benign Het
Zfp947 A T 17: 22,364,813 (GRCm39) M287K probably benign Het
Other mutations in Odf2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00685:Odf2l APN 3 144,833,634 (GRCm39) missense possibly damaging 0.93
IGL00821:Odf2l APN 3 144,856,748 (GRCm39) missense probably damaging 1.00
IGL01984:Odf2l APN 3 144,845,590 (GRCm39) nonsense probably null
R0080:Odf2l UTSW 3 144,830,084 (GRCm39) missense possibly damaging 0.63
R0133:Odf2l UTSW 3 144,854,302 (GRCm39) missense probably damaging 0.96
R0436:Odf2l UTSW 3 144,831,877 (GRCm39) missense possibly damaging 0.91
R1218:Odf2l UTSW 3 144,854,693 (GRCm39) missense probably damaging 1.00
R1677:Odf2l UTSW 3 144,845,543 (GRCm39) critical splice acceptor site probably null
R1884:Odf2l UTSW 3 144,856,809 (GRCm39) missense probably damaging 1.00
R2151:Odf2l UTSW 3 144,854,785 (GRCm39) missense possibly damaging 0.86
R2910:Odf2l UTSW 3 144,830,084 (GRCm39) missense probably benign 0.00
R2911:Odf2l UTSW 3 144,830,084 (GRCm39) missense probably benign 0.00
R4552:Odf2l UTSW 3 144,856,844 (GRCm39) missense probably benign 0.02
R4640:Odf2l UTSW 3 144,834,706 (GRCm39) missense probably damaging 1.00
R4667:Odf2l UTSW 3 144,833,801 (GRCm39) missense probably benign 0.04
R5472:Odf2l UTSW 3 144,852,627 (GRCm39) missense probably benign 0.00
R5769:Odf2l UTSW 3 144,841,492 (GRCm39) missense possibly damaging 0.91
R5877:Odf2l UTSW 3 144,834,771 (GRCm39) splice site probably null
R6026:Odf2l UTSW 3 144,854,797 (GRCm39) missense possibly damaging 0.93
R6031:Odf2l UTSW 3 144,845,624 (GRCm39) missense probably damaging 1.00
R6031:Odf2l UTSW 3 144,845,624 (GRCm39) missense probably damaging 1.00
R6351:Odf2l UTSW 3 144,841,479 (GRCm39) missense probably benign 0.11
R6454:Odf2l UTSW 3 144,859,181 (GRCm39) missense possibly damaging 0.93
R6462:Odf2l UTSW 3 144,852,672 (GRCm39) missense probably damaging 1.00
R6888:Odf2l UTSW 3 144,854,379 (GRCm39) critical splice donor site probably null
R7008:Odf2l UTSW 3 144,838,495 (GRCm39) missense probably damaging 1.00
R7121:Odf2l UTSW 3 144,845,581 (GRCm39) missense possibly damaging 0.93
R7151:Odf2l UTSW 3 144,832,827 (GRCm39) missense probably benign 0.26
R7542:Odf2l UTSW 3 144,859,197 (GRCm39) missense probably damaging 0.99
R7664:Odf2l UTSW 3 144,854,345 (GRCm39) missense probably benign 0.41
R7811:Odf2l UTSW 3 144,859,148 (GRCm39) missense probably benign 0.00
R7816:Odf2l UTSW 3 144,856,776 (GRCm39) missense probably damaging 1.00
R7913:Odf2l UTSW 3 144,859,244 (GRCm39) nonsense probably null
R8090:Odf2l UTSW 3 144,832,796 (GRCm39) missense probably damaging 0.96
R8205:Odf2l UTSW 3 144,856,495 (GRCm39) critical splice acceptor site probably benign
R8222:Odf2l UTSW 3 144,833,799 (GRCm39) missense probably damaging 1.00
R8829:Odf2l UTSW 3 144,833,820 (GRCm39) missense probably benign 0.02
R8832:Odf2l UTSW 3 144,833,820 (GRCm39) missense probably benign 0.02
R8862:Odf2l UTSW 3 144,833,758 (GRCm39) unclassified probably benign
R9136:Odf2l UTSW 3 144,851,698 (GRCm39) missense
R9778:Odf2l UTSW 3 144,854,789 (GRCm39) missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- TGGAAACCAAAGCCTTCTGACCAAG -3'
(R):5'- CATCTGGAAAAGCAGTCCTGGCTC -3'

Sequencing Primer
(F):5'- GTGTCAGGCTGACTTCAAAC -3'
(R):5'- AGCAGTCCTGGCTCAGTAATATC -3'
Posted On 2014-04-13