Incidental Mutation 'R1521:Casp8ap2'
ID 166962
Institutional Source Beutler Lab
Gene Symbol Casp8ap2
Ensembl Gene ENSMUSG00000028282
Gene Name caspase 8 associated protein 2
Synonyms FLASH, D4Ertd659e
MMRRC Submission 040870-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1521 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 32615462-32653271 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32631867 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 96 (E96G)
Ref Sequence ENSEMBL: ENSMUSP00000103813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]
AlphaFold Q9WUF3
Predicted Effect probably damaging
Transcript: ENSMUST00000029950
AA Change: E96G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: E96G

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000108178
AA Change: E96G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282
AA Change: E96G

DomainStartEndE-ValueType
PDB:2LR8|A 126 190 4e-26 PDB
Blast:SANT 139 183 4e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127619
Predicted Effect probably damaging
Transcript: ENSMUST00000178925
AA Change: E96G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: E96G

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 112,713,867 (GRCm39) L104P possibly damaging Het
Adgrf5 T C 17: 43,741,443 (GRCm39) V360A probably benign Het
Ahnak G A 19: 8,982,092 (GRCm39) M1125I probably benign Het
Akap12 T C 10: 4,304,804 (GRCm39) V538A probably benign Het
Arhgef10l T C 4: 140,242,749 (GRCm39) D1088G possibly damaging Het
Atp7b A T 8: 22,517,689 (GRCm39) L268Q probably damaging Het
Atxn2 A C 5: 121,917,654 (GRCm39) N516T probably damaging Het
Cacna1h T C 17: 25,616,328 (GRCm39) M184V possibly damaging Het
Cacnb2 G T 2: 14,619,163 (GRCm39) R66L probably benign Het
Ccdc78 G T 17: 26,007,755 (GRCm39) R264L probably damaging Het
Cdh4 G A 2: 179,439,351 (GRCm39) R166H probably damaging Het
Cog7 C T 7: 121,529,797 (GRCm39) D615N possibly damaging Het
Crtc2 T C 3: 90,164,690 (GRCm39) V115A probably benign Het
Crybg1 A G 10: 43,874,412 (GRCm39) S899P probably damaging Het
Ctdnep1 T A 11: 69,879,461 (GRCm39) V128E probably damaging Het
Ctnna3 A G 10: 64,795,621 (GRCm39) K780E probably benign Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dazap2 T A 15: 100,515,946 (GRCm39) Y91* probably null Het
Dcdc5 T C 2: 106,182,014 (GRCm39) noncoding transcript Het
Dppa1 T A 11: 46,501,300 (GRCm39) R74S possibly damaging Het
Elovl1 A T 4: 118,289,197 (GRCm39) T241S probably benign Het
Eya1 G T 1: 14,344,774 (GRCm39) Q86K probably damaging Het
Fam110d T C 4: 133,978,661 (GRCm39) *272W probably null Het
Fancm A T 12: 65,168,478 (GRCm39) M1614L probably benign Het
Fcgbp C T 7: 27,774,585 (GRCm39) T53I probably benign Het
Fpr3 T A 17: 18,191,277 (GRCm39) W183R probably damaging Het
Galnt13 G A 2: 54,744,657 (GRCm39) V119I probably benign Het
Garin4 T A 1: 190,896,219 (GRCm39) R141S probably benign Het
Gcfc2 T C 6: 81,900,793 (GRCm39) S36P probably benign Het
Gdap2 T A 3: 100,101,931 (GRCm39) D412E possibly damaging Het
Gm12258 T C 11: 58,750,381 (GRCm39) C41R probably damaging Het
Hipk1 T G 3: 103,685,098 (GRCm39) E172D probably benign Het
Hmgcs1 T G 13: 120,165,127 (GRCm39) L326R probably benign Het
Hs6st1 C A 1: 36,107,967 (GRCm39) R77S probably damaging Het
Ifit3 A T 19: 34,564,573 (GRCm39) N40Y probably damaging Het
Il1a T A 2: 129,146,661 (GRCm39) Q144L possibly damaging Het
Itga7 A G 10: 128,793,680 (GRCm39) E1128G possibly damaging Het
Itih2 T C 2: 10,111,558 (GRCm39) D460G probably damaging Het
Ivns1abp G A 1: 151,227,309 (GRCm39) C39Y probably damaging Het
Kif22 G T 7: 126,627,011 (GRCm39) A646E probably damaging Het
Klhl29 T C 12: 5,141,307 (GRCm39) Y559C probably damaging Het
Klhl7 T A 5: 24,354,108 (GRCm39) probably null Het
Klhl9 A G 4: 88,640,230 (GRCm39) S4P probably benign Het
Klk10 A G 7: 43,432,304 (GRCm39) Q79R probably benign Het
Klk6 T C 7: 43,478,699 (GRCm39) probably null Het
Kpna2rt T A 17: 90,217,734 (GRCm39) N4I possibly damaging Het
Lamc2 C T 1: 153,042,009 (GRCm39) E42K probably benign Het
Lingo3 T C 10: 80,671,555 (GRCm39) D125G probably benign Het
Map1b T C 13: 99,569,247 (GRCm39) N1158S unknown Het
Masp1 T A 16: 23,313,387 (GRCm39) N183Y probably damaging Het
Mdga2 A G 12: 66,615,700 (GRCm39) Y636H probably benign Het
Mical2 T A 7: 111,980,817 (GRCm39) S264T probably damaging Het
Mif A G 10: 75,695,375 (GRCm39) V95A possibly damaging Het
Mmp17 G A 5: 129,672,152 (GRCm39) probably null Het
Mmp23 T C 4: 155,735,174 (GRCm39) R390G possibly damaging Het
Ncoa6 A C 2: 155,257,142 (GRCm39) S800R possibly damaging Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Nr2e3 A T 9: 59,856,488 (GRCm39) S67R probably damaging Het
Odf2l T C 3: 144,854,797 (GRCm39) S545P possibly damaging Het
Or10d3 A T 9: 39,462,080 (GRCm39) V29E possibly damaging Het
Or4a47 G A 2: 89,665,516 (GRCm39) R258* probably null Het
Or52s1b T A 7: 102,822,658 (GRCm39) Y62F probably benign Het
Or5k1b C T 16: 58,581,216 (GRCm39) E108K probably damaging Het
Or7e176 A C 9: 20,171,728 (GRCm39) Q197H possibly damaging Het
Or7g27 C T 9: 19,249,948 (GRCm39) S64F probably benign Het
Or8b51 T G 9: 38,569,014 (GRCm39) I225L probably damaging Het
Otog A T 7: 45,908,688 (GRCm39) H562L possibly damaging Het
Pcdh15 T C 10: 74,430,023 (GRCm39) V1250A probably damaging Het
Pde1c A G 6: 56,150,592 (GRCm39) V309A possibly damaging Het
Pfkfb4 A C 9: 108,836,373 (GRCm39) T134P probably damaging Het
Phc3 G T 3: 30,990,724 (GRCm39) Q498K possibly damaging Het
Phlpp1 T C 1: 106,320,049 (GRCm39) V1348A probably damaging Het
Pik3ap1 T C 19: 41,309,997 (GRCm39) D441G probably damaging Het
Pkd1l2 T C 8: 117,792,239 (GRCm39) probably null Het
Pla2g4a T C 1: 149,733,437 (GRCm39) probably null Het
Pola2 A T 19: 5,998,434 (GRCm39) I376N probably damaging Het
Pold2 T A 11: 5,826,833 (GRCm39) N34Y probably damaging Het
Ppp2r5c T C 12: 110,521,320 (GRCm39) L281P probably damaging Het
Prss46 A G 9: 110,678,703 (GRCm39) I29V probably benign Het
Ranbp6 A T 19: 29,788,846 (GRCm39) V502E probably benign Het
Rdh14 T C 12: 10,444,613 (GRCm39) F155L probably damaging Het
Rnaseh2a A T 8: 85,692,487 (GRCm39) probably null Het
Rpp30 A G 19: 36,071,785 (GRCm39) T118A possibly damaging Het
Rragd T C 4: 32,996,005 (GRCm39) F117L probably damaging Het
Rxylt1 A G 10: 121,926,384 (GRCm39) W243R probably damaging Het
S100a2 T A 3: 90,498,599 (GRCm39) probably null Het
Septin12 T C 16: 4,814,340 (GRCm39) K43R probably damaging Het
Sh3tc2 A G 18: 62,141,559 (GRCm39) E1080G probably damaging Het
Slc26a9 A G 1: 131,678,415 (GRCm39) K27R probably damaging Het
Spata17 T A 1: 186,926,191 (GRCm39) K46N probably damaging Het
St14 A C 9: 31,019,511 (GRCm39) D103E probably benign Het
St6galnac2 T A 11: 116,575,173 (GRCm39) Q222L possibly damaging Het
Tdrd9 T C 12: 112,002,844 (GRCm39) V831A probably damaging Het
Tert A G 13: 73,790,175 (GRCm39) E843G probably damaging Het
Tex21 A G 12: 76,251,044 (GRCm39) V464A probably benign Het
Tmem232 T A 17: 65,791,496 (GRCm39) H124L probably damaging Het
Tnfrsf19 T G 14: 61,242,555 (GRCm39) S110R probably damaging Het
Tnnt3 A T 7: 142,069,562 (GRCm39) K272* probably null Het
Tnxb T C 17: 34,930,477 (GRCm39) L2054P probably damaging Het
Trcg1 A C 9: 57,149,748 (GRCm39) D440A probably benign Het
Trpm3 A G 19: 22,878,585 (GRCm39) E504G probably damaging Het
Trpm5 C T 7: 142,636,626 (GRCm39) R437H probably benign Het
Ttn T C 2: 76,571,511 (GRCm39) R18134G probably damaging Het
Uchl5 A C 1: 143,674,160 (GRCm39) M64L possibly damaging Het
Urb1 G A 16: 90,550,751 (GRCm39) R2034W probably damaging Het
Usp44 T A 10: 93,683,048 (GRCm39) C452* probably null Het
Uvssa G A 5: 33,571,278 (GRCm39) A641T probably damaging Het
Vmn1r204 T A 13: 22,741,248 (GRCm39) I293N probably benign Het
Vmn2r84 A T 10: 130,225,137 (GRCm39) C458S probably benign Het
Vmn2r85 T G 10: 130,261,788 (GRCm39) H183P probably damaging Het
Vps13d G T 4: 144,832,431 (GRCm39) T2825K probably benign Het
Zc3hc1 T A 6: 30,376,024 (GRCm39) I179F probably benign Het
Zfp112 A G 7: 23,825,210 (GRCm39) N393D probably damaging Het
Zfp558 A G 9: 18,367,859 (GRCm39) S310P possibly damaging Het
Zfp560 A C 9: 20,260,071 (GRCm39) probably null Het
Zfp668 C T 7: 127,466,252 (GRCm39) E311K probably benign Het
Zfp763 T A 17: 33,252,276 (GRCm39) M1L probably benign Het
Zfp947 A T 17: 22,364,813 (GRCm39) M287K probably benign Het
Other mutations in Casp8ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00686:Casp8ap2 APN 4 32,641,433 (GRCm39) missense probably damaging 1.00
IGL00714:Casp8ap2 APN 4 32,649,192 (GRCm39) missense probably damaging 1.00
IGL00754:Casp8ap2 APN 4 32,641,036 (GRCm39) missense probably benign 0.00
IGL00954:Casp8ap2 APN 4 32,645,403 (GRCm39) missense probably damaging 1.00
IGL00970:Casp8ap2 APN 4 32,646,182 (GRCm39) missense probably benign
IGL01534:Casp8ap2 APN 4 32,648,134 (GRCm39) splice site probably benign
IGL01596:Casp8ap2 APN 4 32,646,365 (GRCm39) missense probably damaging 1.00
IGL01686:Casp8ap2 APN 4 32,641,294 (GRCm39) missense possibly damaging 0.94
IGL02002:Casp8ap2 APN 4 32,639,391 (GRCm39) missense probably damaging 1.00
IGL02273:Casp8ap2 APN 4 32,643,974 (GRCm39) missense probably damaging 1.00
IGL02510:Casp8ap2 APN 4 32,639,704 (GRCm39) missense probably benign 0.05
IGL02600:Casp8ap2 APN 4 32,630,246 (GRCm39) missense probably null 1.00
IGL02929:Casp8ap2 APN 4 32,624,105 (GRCm39) utr 5 prime probably benign
F5770:Casp8ap2 UTSW 4 32,639,944 (GRCm39) missense probably benign 0.00
IGL02988:Casp8ap2 UTSW 4 32,644,590 (GRCm39) missense probably benign 0.14
R0023:Casp8ap2 UTSW 4 32,640,185 (GRCm39) missense probably damaging 0.99
R0027:Casp8ap2 UTSW 4 32,643,810 (GRCm39) missense probably benign 0.01
R0090:Casp8ap2 UTSW 4 32,640,327 (GRCm39) missense probably damaging 1.00
R0117:Casp8ap2 UTSW 4 32,640,817 (GRCm39) missense probably benign 0.00
R0144:Casp8ap2 UTSW 4 32,643,797 (GRCm39) missense possibly damaging 0.50
R0268:Casp8ap2 UTSW 4 32,644,079 (GRCm39) missense probably damaging 0.99
R0344:Casp8ap2 UTSW 4 32,644,079 (GRCm39) missense probably damaging 0.99
R0555:Casp8ap2 UTSW 4 32,640,381 (GRCm39) missense probably damaging 1.00
R1051:Casp8ap2 UTSW 4 32,640,790 (GRCm39) missense probably benign 0.28
R1165:Casp8ap2 UTSW 4 32,640,563 (GRCm39) missense probably benign 0.01
R1243:Casp8ap2 UTSW 4 32,645,687 (GRCm39) missense probably benign 0.03
R1311:Casp8ap2 UTSW 4 32,648,111 (GRCm39) missense probably damaging 0.98
R1337:Casp8ap2 UTSW 4 32,645,721 (GRCm39) missense possibly damaging 0.64
R1471:Casp8ap2 UTSW 4 32,639,386 (GRCm39) nonsense probably null
R1497:Casp8ap2 UTSW 4 32,639,938 (GRCm39) missense probably benign 0.00
R1588:Casp8ap2 UTSW 4 32,640,541 (GRCm39) missense probably benign 0.00
R1625:Casp8ap2 UTSW 4 32,648,068 (GRCm39) missense probably benign 0.04
R1731:Casp8ap2 UTSW 4 32,641,442 (GRCm39) missense possibly damaging 0.94
R1899:Casp8ap2 UTSW 4 32,643,647 (GRCm39) missense probably damaging 0.98
R2000:Casp8ap2 UTSW 4 32,634,874 (GRCm39) missense probably damaging 1.00
R2021:Casp8ap2 UTSW 4 32,644,560 (GRCm39) missense probably benign 0.05
R2022:Casp8ap2 UTSW 4 32,644,560 (GRCm39) missense probably benign 0.05
R2023:Casp8ap2 UTSW 4 32,644,560 (GRCm39) missense probably benign 0.05
R2088:Casp8ap2 UTSW 4 32,631,126 (GRCm39) missense probably damaging 1.00
R2104:Casp8ap2 UTSW 4 32,644,727 (GRCm39) missense probably benign 0.00
R2128:Casp8ap2 UTSW 4 32,640,142 (GRCm39) missense probably benign 0.06
R2129:Casp8ap2 UTSW 4 32,640,142 (GRCm39) missense probably benign 0.06
R2305:Casp8ap2 UTSW 4 32,646,411 (GRCm39) missense probably damaging 1.00
R2316:Casp8ap2 UTSW 4 32,643,781 (GRCm39) missense probably benign 0.31
R2919:Casp8ap2 UTSW 4 32,645,343 (GRCm39) missense probably damaging 1.00
R4091:Casp8ap2 UTSW 4 32,643,611 (GRCm39) missense probably damaging 1.00
R4357:Casp8ap2 UTSW 4 32,646,150 (GRCm39) missense probably benign 0.00
R4807:Casp8ap2 UTSW 4 32,644,505 (GRCm39) missense possibly damaging 0.89
R4828:Casp8ap2 UTSW 4 32,639,807 (GRCm39) missense probably benign
R4908:Casp8ap2 UTSW 4 32,639,905 (GRCm39) missense possibly damaging 0.90
R4945:Casp8ap2 UTSW 4 32,631,163 (GRCm39) missense possibly damaging 0.57
R4962:Casp8ap2 UTSW 4 32,640,554 (GRCm39) missense probably damaging 0.99
R6014:Casp8ap2 UTSW 4 32,641,400 (GRCm39) missense probably damaging 0.97
R6092:Casp8ap2 UTSW 4 32,639,380 (GRCm39) missense probably damaging 1.00
R6257:Casp8ap2 UTSW 4 32,641,364 (GRCm39) missense possibly damaging 0.94
R6289:Casp8ap2 UTSW 4 32,639,590 (GRCm39) missense probably damaging 1.00
R6482:Casp8ap2 UTSW 4 32,634,813 (GRCm39) missense probably damaging 1.00
R6496:Casp8ap2 UTSW 4 32,641,553 (GRCm39) missense probably benign 0.05
R6515:Casp8ap2 UTSW 4 32,646,423 (GRCm39) missense possibly damaging 0.64
R7015:Casp8ap2 UTSW 4 32,644,278 (GRCm39) missense probably damaging 1.00
R7033:Casp8ap2 UTSW 4 32,639,392 (GRCm39) missense probably damaging 1.00
R7072:Casp8ap2 UTSW 4 32,644,766 (GRCm39) missense probably damaging 1.00
R7448:Casp8ap2 UTSW 4 32,643,974 (GRCm39) missense possibly damaging 0.84
R7944:Casp8ap2 UTSW 4 32,645,909 (GRCm39) missense probably benign 0.12
R7945:Casp8ap2 UTSW 4 32,645,909 (GRCm39) missense probably benign 0.12
R8170:Casp8ap2 UTSW 4 32,615,490 (GRCm39) splice site probably benign
R8179:Casp8ap2 UTSW 4 32,643,939 (GRCm39) nonsense probably null
R8207:Casp8ap2 UTSW 4 32,646,446 (GRCm39) missense possibly damaging 0.63
R8263:Casp8ap2 UTSW 4 32,644,072 (GRCm39) missense probably damaging 1.00
R8298:Casp8ap2 UTSW 4 32,640,429 (GRCm39) missense probably benign 0.30
R9441:Casp8ap2 UTSW 4 32,645,873 (GRCm39) missense probably benign 0.00
R9455:Casp8ap2 UTSW 4 32,643,924 (GRCm39) missense possibly damaging 0.85
R9729:Casp8ap2 UTSW 4 32,643,807 (GRCm39) missense possibly damaging 0.71
V7580:Casp8ap2 UTSW 4 32,639,944 (GRCm39) missense probably benign 0.00
X0018:Casp8ap2 UTSW 4 32,643,738 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGAGGCAACGTACAATGACGTATGA -3'
(R):5'- CAACGGGCTGCctggaaagataa -3'

Sequencing Primer
(F):5'- gctcagtagtgaagcagcc -3'
(R):5'- gaactcacaggaaaagccatc -3'
Posted On 2014-04-13