Mutagenetix > Incidental Mutation

Incidental Mutation 'R1521:Casp8ap2'

166962

Institutional Source

Beutler Lab

Gene Symbol

Casp8ap2

Ensembl Gene

ENSMUSG00000028282

Gene Name

caspase 8 associated protein 2

Synonyms

FLASH, D4Ertd659e

MMRRC Submission

040870-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1521 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32615451-32653265 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 32631867 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 96 (E96G)

Ref Sequence

ENSEMBL: ENSMUSP00000103813 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]

AlphaFold

Q9WUF3

Predicted Effect

probably damaging
Transcript: ENSMUST00000029950
AA Change: E96G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: E96G

Domain	Start	End	E-Value	Type
coiled coil region	68	142	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	458	477	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1250	1268	N/A	INTRINSIC
low complexity region	1360	1377	N/A	INTRINSIC
low complexity region	1458	1470	N/A	INTRINSIC
low complexity region	1477	1498	N/A	INTRINSIC
low complexity region	1882	1895	N/A	INTRINSIC
PDB:2LR8\|A	1896	1962	1e-31	PDB
Blast:SANT	1905	1955	2e-21	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000108178
AA Change: E96G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282
AA Change: E96G

Domain	Start	End	E-Value	Type
PDB:2LR8\|A	126	190	4e-26	PDB
Blast:SANT	139	183	4e-19	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124278

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127619

Predicted Effect

probably damaging
Transcript: ENSMUST00000178925
AA Change: E96G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: E96G

Domain	Start	End	E-Value	Type
coiled coil region	68	142	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	458	477	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1250	1268	N/A	INTRINSIC
low complexity region	1360	1377	N/A	INTRINSIC
low complexity region	1458	1470	N/A	INTRINSIC
low complexity region	1477	1498	N/A	INTRINSIC
low complexity region	1882	1895	N/A	INTRINSIC
PDB:2LR8\|A	1896	1962	1e-31	PDB
Blast:SANT	1905	1955	2e-21	BLAST

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 118 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adat1	A	G	8: 111,987,235	L104P	possibly damaging	Het
Adgrf5	T	C	17: 43,430,552	V360A	probably benign	Het
Ahnak	G	A	19: 9,004,728	M1125I	probably benign	Het
Akap12	T	C	10: 4,354,804	V538A	probably benign	Het
Arhgef10l	T	C	4: 140,515,438	D1088G	possibly damaging	Het
Atp7b	A	T	8: 22,027,673	L268Q	probably damaging	Het
Atxn2	A	C	5: 121,779,591	N516T	probably damaging	Het
Cacna1h	T	C	17: 25,397,354	M184V	possibly damaging	Het
Cacnb2	G	T	2: 14,614,352	R66L	probably benign	Het
Ccdc78	G	T	17: 25,788,781	R264L	probably damaging	Het
Cdh4	G	A	2: 179,797,558	R166H	probably damaging	Het
Cog7	C	T	7: 121,930,574	D615N	possibly damaging	Het
Crtc2	T	C	3: 90,257,383	V115A	probably benign	Het
Crybg1	A	G	10: 43,998,416	S899P	probably damaging	Het
Ctdnep1	T	A	11: 69,988,635	V128E	probably damaging	Het
Ctnna3	A	G	10: 64,959,842	K780E	probably benign	Het
Cul7	T	A	17: 46,663,190	L1467H	probably damaging	Het
Dazap2	T	A	15: 100,618,065	Y91*	probably null	Het
Dcdc5	T	C	2: 106,351,669		noncoding transcript	Het
Dppa1	T	A	11: 46,610,473	R74S	possibly damaging	Het
Elovl1	A	T	4: 118,432,000	T241S	probably benign	Het
Eya1	G	T	1: 14,274,550	Q86K	probably damaging	Het
Fam71a	T	A	1: 191,164,022	R141S	probably benign	Het
Fancm	A	T	12: 65,121,704	M1614L	probably benign	Het
Fcgbp	C	T	7: 28,075,160	T53I	probably benign	Het
Fpr3	T	A	17: 17,971,015	W183R	probably damaging	Het
Galnt13	G	A	2: 54,854,645	V119I	probably benign	Het
Gcfc2	T	C	6: 81,923,812	S36P	probably benign	Het
Gdap2	T	A	3: 100,194,615	D412E	possibly damaging	Het
Gm10184	T	A	17: 89,910,306	N4I	possibly damaging	Het
Gm12258	T	C	11: 58,859,555	C41R	probably damaging	Het
Grrp1	T	C	4: 134,251,350	*272W	probably null	Het
Hipk1	T	G	3: 103,777,782	E172D	probably benign	Het
Hmgcs1	T	G	13: 119,703,591	L326R	probably benign	Het
Hs6st1	C	A	1: 36,068,886	R77S	probably damaging	Het
Ifit3	A	T	19: 34,587,173	N40Y	probably damaging	Het
Il1a	T	A	2: 129,304,741	Q144L	possibly damaging	Het
Itga7	A	G	10: 128,957,811	E1128G	possibly damaging	Het
Itih2	T	C	2: 10,106,747	D460G	probably damaging	Het
Ivns1abp	G	A	1: 151,351,558	C39Y	probably damaging	Het
Kif22	G	T	7: 127,027,839	A646E	probably damaging	Het
Klhl29	T	C	12: 5,091,307	Y559C	probably damaging	Het
Klhl7	T	A	5: 24,149,110		probably null	Het
Klhl9	A	G	4: 88,721,993	S4P	probably benign	Het
Klk10	A	G	7: 43,782,880	Q79R	probably benign	Het
Klk6	T	C	7: 43,829,275		probably null	Het
Lamc2	C	T	1: 153,166,263	E42K	probably benign	Het
Lingo3	T	C	10: 80,835,721	D125G	probably benign	Het
Map1b	T	C	13: 99,432,739	N1158S	unknown	Het
Masp1	T	A	16: 23,494,637	N183Y	probably damaging	Het
Mdga2	A	G	12: 66,568,926	Y636H	probably benign	Het
Micalcl	T	A	7: 112,381,610	S264T	probably damaging	Het
Mif	A	G	10: 75,859,541	V95A	possibly damaging	Het
Mmp17	G	A	5: 129,595,088		probably null	Het
Mmp23	T	C	4: 155,650,717	R390G	possibly damaging	Het
Ncoa6	A	C	2: 155,415,222	S800R	possibly damaging	Het
Nfix	G	A	8: 84,726,526	R300C	probably damaging	Het
Nr2e3	A	T	9: 59,949,205	S67R	probably damaging	Het
Odf2l	T	C	3: 145,149,036	S545P	possibly damaging	Het
Olfr1256	G	A	2: 89,835,172	R258*	probably null	Het
Olfr172	C	T	16: 58,760,853	E108K	probably damaging	Het
Olfr591	T	A	7: 103,173,451	Y62F	probably benign	Het
Olfr845	C	T	9: 19,338,652	S64F	probably benign	Het
Olfr872	A	C	9: 20,260,432	Q197H	possibly damaging	Het
Olfr916	T	G	9: 38,657,718	I225L	probably damaging	Het
Olfr958	A	T	9: 39,550,784	V29E	possibly damaging	Het
Otog	A	T	7: 46,259,264	H562L	possibly damaging	Het
Pcdh15	T	C	10: 74,594,191	V1250A	probably damaging	Het
Pde1c	A	G	6: 56,173,607	V309A	possibly damaging	Het
Pfkfb4	A	C	9: 109,007,305	T134P	probably damaging	Het
Phc3	G	T	3: 30,936,575	Q498K	possibly damaging	Het
Phlpp1	T	C	1: 106,392,319	V1348A	probably damaging	Het
Pik3ap1	T	C	19: 41,321,558	D441G	probably damaging	Het
Pkd1l2	T	C	8: 117,065,500		probably null	Het
Pla2g4a	T	C	1: 149,857,686		probably null	Het
Pola2	A	T	19: 5,948,406	I376N	probably damaging	Het
Pold2	T	A	11: 5,876,833	N34Y	probably damaging	Het
Ppp2r5c	T	C	12: 110,554,886	L281P	probably damaging	Het
Prss46	A	G	9: 110,849,635	I29V	probably benign	Het
Ranbp6	A	T	19: 29,811,446	V502E	probably benign	Het
Rdh14	T	C	12: 10,394,613	F155L	probably damaging	Het
Rnaseh2a	A	T	8: 84,965,858		probably null	Het
Rpp30	A	G	19: 36,094,385	T118A	possibly damaging	Het
Rragd	T	C	4: 32,996,005	F117L	probably damaging	Het
S100a2	T	A	3: 90,591,292		probably null	Het
Sept12	T	C	16: 4,996,476	K43R	probably damaging	Het
Sh3tc2	A	G	18: 62,008,488	E1080G	probably damaging	Het
Slc26a9	A	G	1: 131,750,677	K27R	probably damaging	Het
Spata17	T	A	1: 187,193,994	K46N	probably damaging	Het
St14	A	C	9: 31,108,215	D103E	probably benign	Het
St6galnac2	T	A	11: 116,684,347	Q222L	possibly damaging	Het
Tdrd9	T	C	12: 112,036,410	V831A	probably damaging	Het
Tert	A	G	13: 73,642,056	E843G	probably damaging	Het
Tex21	A	G	12: 76,204,270	V464A	probably benign	Het
Tmem232	T	A	17: 65,484,501	H124L	probably damaging	Het
Tmem5	A	G	10: 122,090,479	W243R	probably damaging	Het
Tnfrsf19	T	G	14: 61,005,106	S110R	probably damaging	Het
Tnnt3	A	T	7: 142,515,825	K272*	probably null	Het
Tnxb	T	C	17: 34,711,503	L2054P	probably damaging	Het
Trcg1	A	C	9: 57,242,465	D440A	probably benign	Het
Trpm3	A	G	19: 22,901,221	E504G	probably damaging	Het
Trpm5	C	T	7: 143,082,889	R437H	probably benign	Het
Ttn	T	C	2: 76,741,167	R18134G	probably damaging	Het
Uchl5	A	C	1: 143,798,422	M64L	possibly damaging	Het
Urb1	G	A	16: 90,753,863	R2034W	probably damaging	Het
Usp44	T	A	10: 93,847,186	C452*	probably null	Het
Uvssa	G	A	5: 33,413,934	A641T	probably damaging	Het
Vmn1r204	T	A	13: 22,557,078	I293N	probably benign	Het
Vmn2r84	A	T	10: 130,389,268	C458S	probably benign	Het
Vmn2r85	T	G	10: 130,425,919	H183P	probably damaging	Het
Vps13d	G	T	4: 145,105,861	T2825K	probably benign	Het
Zc3hc1	T	A	6: 30,376,025	I179F	probably benign	Het
Zfp112	A	G	7: 24,125,785	N393D	probably damaging	Het
Zfp558	A	G	9: 18,456,563	S310P	possibly damaging	Het
Zfp560	A	C	9: 20,348,775		probably null	Het
Zfp668	C	T	7: 127,867,080	E311K	probably benign	Het
Zfp763	T	A	17: 33,033,302	M1L	probably benign	Het
Zfp947	A	T	17: 22,145,832	M287K	probably benign	Het

Other mutations in Casp8ap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00686:Casp8ap2	APN	4	32641433	missense	probably damaging	1.00
IGL00714:Casp8ap2	APN	4	32649192	missense	probably damaging	1.00
IGL00754:Casp8ap2	APN	4	32641036	missense	probably benign	0.00
IGL00954:Casp8ap2	APN	4	32645403	missense	probably damaging	1.00
IGL00970:Casp8ap2	APN	4	32646182	missense	probably benign
IGL01534:Casp8ap2	APN	4	32648134	splice site	probably benign
IGL01596:Casp8ap2	APN	4	32646365	missense	probably damaging	1.00
IGL01686:Casp8ap2	APN	4	32641294	missense	possibly damaging	0.94
IGL02002:Casp8ap2	APN	4	32639391	missense	probably damaging	1.00
IGL02273:Casp8ap2	APN	4	32643974	missense	probably damaging	1.00
IGL02510:Casp8ap2	APN	4	32639704	missense	probably benign	0.05
IGL02600:Casp8ap2	APN	4	32630246	missense	probably null	1.00
IGL02929:Casp8ap2	APN	4	32624105	utr 5 prime	probably benign
F5770:Casp8ap2	UTSW	4	32639944	missense	probably benign	0.00
IGL02988:Casp8ap2	UTSW	4	32644590	missense	probably benign	0.14
R0023:Casp8ap2	UTSW	4	32640185	missense	probably damaging	0.99
R0027:Casp8ap2	UTSW	4	32643810	missense	probably benign	0.01
R0090:Casp8ap2	UTSW	4	32640327	missense	probably damaging	1.00
R0117:Casp8ap2	UTSW	4	32640817	missense	probably benign	0.00
R0144:Casp8ap2	UTSW	4	32643797	missense	possibly damaging	0.50
R0268:Casp8ap2	UTSW	4	32644079	missense	probably damaging	0.99
R0344:Casp8ap2	UTSW	4	32644079	missense	probably damaging	0.99
R0555:Casp8ap2	UTSW	4	32640381	missense	probably damaging	1.00
R1051:Casp8ap2	UTSW	4	32640790	missense	probably benign	0.28
R1165:Casp8ap2	UTSW	4	32640563	missense	probably benign	0.01
R1243:Casp8ap2	UTSW	4	32645687	missense	probably benign	0.03
R1311:Casp8ap2	UTSW	4	32648111	missense	probably damaging	0.98
R1337:Casp8ap2	UTSW	4	32645721	missense	possibly damaging	0.64
R1471:Casp8ap2	UTSW	4	32639386	nonsense	probably null
R1497:Casp8ap2	UTSW	4	32639938	missense	probably benign	0.00
R1588:Casp8ap2	UTSW	4	32640541	missense	probably benign	0.00
R1625:Casp8ap2	UTSW	4	32648068	missense	probably benign	0.04
R1731:Casp8ap2	UTSW	4	32641442	missense	possibly damaging	0.94
R1899:Casp8ap2	UTSW	4	32643647	missense	probably damaging	0.98
R2000:Casp8ap2	UTSW	4	32634874	missense	probably damaging	1.00
R2021:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2022:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2023:Casp8ap2	UTSW	4	32644560	missense	probably benign	0.05
R2088:Casp8ap2	UTSW	4	32631126	missense	probably damaging	1.00
R2104:Casp8ap2	UTSW	4	32644727	missense	probably benign	0.00
R2128:Casp8ap2	UTSW	4	32640142	missense	probably benign	0.06
R2129:Casp8ap2	UTSW	4	32640142	missense	probably benign	0.06
R2305:Casp8ap2	UTSW	4	32646411	missense	probably damaging	1.00
R2316:Casp8ap2	UTSW	4	32643781	missense	probably benign	0.31
R2919:Casp8ap2	UTSW	4	32645343	missense	probably damaging	1.00
R4091:Casp8ap2	UTSW	4	32643611	missense	probably damaging	1.00
R4357:Casp8ap2	UTSW	4	32646150	missense	probably benign	0.00
R4807:Casp8ap2	UTSW	4	32644505	missense	possibly damaging	0.89
R4828:Casp8ap2	UTSW	4	32639807	missense	probably benign
R4908:Casp8ap2	UTSW	4	32639905	missense	possibly damaging	0.90
R4945:Casp8ap2	UTSW	4	32631163	missense	possibly damaging	0.57
R4962:Casp8ap2	UTSW	4	32640554	missense	probably damaging	0.99
R6014:Casp8ap2	UTSW	4	32641400	missense	probably damaging	0.97
R6092:Casp8ap2	UTSW	4	32639380	missense	probably damaging	1.00
R6257:Casp8ap2	UTSW	4	32641364	missense	possibly damaging	0.94
R6289:Casp8ap2	UTSW	4	32639590	missense	probably damaging	1.00
R6482:Casp8ap2	UTSW	4	32634813	missense	probably damaging	1.00
R6496:Casp8ap2	UTSW	4	32641553	missense	probably benign	0.05
R6515:Casp8ap2	UTSW	4	32646423	missense	possibly damaging	0.64
R7015:Casp8ap2	UTSW	4	32644278	missense	probably damaging	1.00
R7033:Casp8ap2	UTSW	4	32639392	missense	probably damaging	1.00
R7072:Casp8ap2	UTSW	4	32644766	missense	probably damaging	1.00
R7448:Casp8ap2	UTSW	4	32643974	missense	possibly damaging	0.84
R7944:Casp8ap2	UTSW	4	32645909	missense	probably benign	0.12
R7945:Casp8ap2	UTSW	4	32645909	missense	probably benign	0.12
R8170:Casp8ap2	UTSW	4	32615490	splice site	probably benign
R8179:Casp8ap2	UTSW	4	32643939	nonsense	probably null
R8207:Casp8ap2	UTSW	4	32646446	missense	possibly damaging	0.63
R8263:Casp8ap2	UTSW	4	32644072	missense	probably damaging	1.00
R8298:Casp8ap2	UTSW	4	32640429	missense	probably benign	0.30
R9441:Casp8ap2	UTSW	4	32645873	missense	probably benign	0.00
R9455:Casp8ap2	UTSW	4	32643924	missense	possibly damaging	0.85
R9729:Casp8ap2	UTSW	4	32643807	missense	possibly damaging	0.71
V7580:Casp8ap2	UTSW	4	32639944	missense	probably benign	0.00
X0018:Casp8ap2	UTSW	4	32643738	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GGAGGCAACGTACAATGACGTATGA -3'
(R):5'- CAACGGGCTGCctggaaagataa -3'

Sequencing Primer
(F):5'- gctcagtagtgaagcagcc -3'
(R):5'- gaactcacaggaaaagccatc -3'

Posted On

2014-04-13