Incidental Mutation 'R1521:Fcgbp'
ID166983
Institutional Source Beutler Lab
Gene Symbol Fcgbp
Ensembl Gene ENSMUSG00000047730
Gene NameFc fragment of IgG binding protein
SynonymsA430096B05Rik
MMRRC Submission 040870-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1521 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28071236-28120862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28075160 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 53 (T53I)
Ref Sequence ENSEMBL: ENSMUSP00000114271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076648] [ENSMUST00000138392]
Predicted Effect probably benign
Transcript: ENSMUST00000076648
AA Change: T53I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075945
Gene: ENSMUSG00000047730
AA Change: T53I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 1.2e-12 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 6.85e-35 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 4.7e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.7e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 5e-12 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138392
AA Change: T53I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000114271
Gene: ENSMUSG00000047730
AA Change: T53I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 8.4e-13 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 7.99e-36 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 3.3e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.9e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 1e-11 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140004
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 111,987,235 L104P possibly damaging Het
Adgrf5 T C 17: 43,430,552 V360A probably benign Het
Ahnak G A 19: 9,004,728 M1125I probably benign Het
Akap12 T C 10: 4,354,804 V538A probably benign Het
Arhgef10l T C 4: 140,515,438 D1088G possibly damaging Het
Atp7b A T 8: 22,027,673 L268Q probably damaging Het
Atxn2 A C 5: 121,779,591 N516T probably damaging Het
Cacna1h T C 17: 25,397,354 M184V possibly damaging Het
Cacnb2 G T 2: 14,614,352 R66L probably benign Het
Casp8ap2 A G 4: 32,631,867 E96G probably damaging Het
Ccdc78 G T 17: 25,788,781 R264L probably damaging Het
Cdh4 G A 2: 179,797,558 R166H probably damaging Het
Cog7 C T 7: 121,930,574 D615N possibly damaging Het
Crtc2 T C 3: 90,257,383 V115A probably benign Het
Crybg1 A G 10: 43,998,416 S899P probably damaging Het
Ctdnep1 T A 11: 69,988,635 V128E probably damaging Het
Ctnna3 A G 10: 64,959,842 K780E probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dazap2 T A 15: 100,618,065 Y91* probably null Het
Dcdc5 T C 2: 106,351,669 noncoding transcript Het
Dppa1 T A 11: 46,610,473 R74S possibly damaging Het
Elovl1 A T 4: 118,432,000 T241S probably benign Het
Eya1 G T 1: 14,274,550 Q86K probably damaging Het
Fam71a T A 1: 191,164,022 R141S probably benign Het
Fancm A T 12: 65,121,704 M1614L probably benign Het
Fpr3 T A 17: 17,971,015 W183R probably damaging Het
Galnt13 G A 2: 54,854,645 V119I probably benign Het
Gcfc2 T C 6: 81,923,812 S36P probably benign Het
Gdap2 T A 3: 100,194,615 D412E possibly damaging Het
Gm10184 T A 17: 89,910,306 N4I possibly damaging Het
Gm12258 T C 11: 58,859,555 C41R probably damaging Het
Grrp1 T C 4: 134,251,350 *272W probably null Het
Hipk1 T G 3: 103,777,782 E172D probably benign Het
Hmgcs1 T G 13: 119,703,591 L326R probably benign Het
Hs6st1 C A 1: 36,068,886 R77S probably damaging Het
Ifit3 A T 19: 34,587,173 N40Y probably damaging Het
Il1a T A 2: 129,304,741 Q144L possibly damaging Het
Itga7 A G 10: 128,957,811 E1128G possibly damaging Het
Itih2 T C 2: 10,106,747 D460G probably damaging Het
Ivns1abp G A 1: 151,351,558 C39Y probably damaging Het
Kif22 G T 7: 127,027,839 A646E probably damaging Het
Klhl29 T C 12: 5,091,307 Y559C probably damaging Het
Klhl7 T A 5: 24,149,110 probably null Het
Klhl9 A G 4: 88,721,993 S4P probably benign Het
Klk10 A G 7: 43,782,880 Q79R probably benign Het
Klk6 T C 7: 43,829,275 probably null Het
Lamc2 C T 1: 153,166,263 E42K probably benign Het
Lingo3 T C 10: 80,835,721 D125G probably benign Het
Map1b T C 13: 99,432,739 N1158S unknown Het
Masp1 T A 16: 23,494,637 N183Y probably damaging Het
Mdga2 A G 12: 66,568,926 Y636H probably benign Het
Micalcl T A 7: 112,381,610 S264T probably damaging Het
Mif A G 10: 75,859,541 V95A possibly damaging Het
Mmp17 G A 5: 129,595,088 probably null Het
Mmp23 T C 4: 155,650,717 R390G possibly damaging Het
Ncoa6 A C 2: 155,415,222 S800R possibly damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nr2e3 A T 9: 59,949,205 S67R probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr1256 G A 2: 89,835,172 R258* probably null Het
Olfr172 C T 16: 58,760,853 E108K probably damaging Het
Olfr591 T A 7: 103,173,451 Y62F probably benign Het
Olfr845 C T 9: 19,338,652 S64F probably benign Het
Olfr872 A C 9: 20,260,432 Q197H possibly damaging Het
Olfr916 T G 9: 38,657,718 I225L probably damaging Het
Olfr958 A T 9: 39,550,784 V29E possibly damaging Het
Otog A T 7: 46,259,264 H562L possibly damaging Het
Pcdh15 T C 10: 74,594,191 V1250A probably damaging Het
Pde1c A G 6: 56,173,607 V309A possibly damaging Het
Pfkfb4 A C 9: 109,007,305 T134P probably damaging Het
Phc3 G T 3: 30,936,575 Q498K possibly damaging Het
Phlpp1 T C 1: 106,392,319 V1348A probably damaging Het
Pik3ap1 T C 19: 41,321,558 D441G probably damaging Het
Pkd1l2 T C 8: 117,065,500 probably null Het
Pla2g4a T C 1: 149,857,686 probably null Het
Pola2 A T 19: 5,948,406 I376N probably damaging Het
Pold2 T A 11: 5,876,833 N34Y probably damaging Het
Ppp2r5c T C 12: 110,554,886 L281P probably damaging Het
Prss46 A G 9: 110,849,635 I29V probably benign Het
Ranbp6 A T 19: 29,811,446 V502E probably benign Het
Rdh14 T C 12: 10,394,613 F155L probably damaging Het
Rnaseh2a A T 8: 84,965,858 probably null Het
Rpp30 A G 19: 36,094,385 T118A possibly damaging Het
Rragd T C 4: 32,996,005 F117L probably damaging Het
S100a2 T A 3: 90,591,292 probably null Het
Sept12 T C 16: 4,996,476 K43R probably damaging Het
Sh3tc2 A G 18: 62,008,488 E1080G probably damaging Het
Slc26a9 A G 1: 131,750,677 K27R probably damaging Het
Spata17 T A 1: 187,193,994 K46N probably damaging Het
St14 A C 9: 31,108,215 D103E probably benign Het
St6galnac2 T A 11: 116,684,347 Q222L possibly damaging Het
Tdrd9 T C 12: 112,036,410 V831A probably damaging Het
Tert A G 13: 73,642,056 E843G probably damaging Het
Tex21 A G 12: 76,204,270 V464A probably benign Het
Tmem232 T A 17: 65,484,501 H124L probably damaging Het
Tmem5 A G 10: 122,090,479 W243R probably damaging Het
Tnfrsf19 T G 14: 61,005,106 S110R probably damaging Het
Tnnt3 A T 7: 142,515,825 K272* probably null Het
Tnxb T C 17: 34,711,503 L2054P probably damaging Het
Trcg1 A C 9: 57,242,465 D440A probably benign Het
Trpm3 A G 19: 22,901,221 E504G probably damaging Het
Trpm5 C T 7: 143,082,889 R437H probably benign Het
Ttn T C 2: 76,741,167 R18134G probably damaging Het
Uchl5 A C 1: 143,798,422 M64L possibly damaging Het
Urb1 G A 16: 90,753,863 R2034W probably damaging Het
Usp44 T A 10: 93,847,186 C452* probably null Het
Uvssa G A 5: 33,413,934 A641T probably damaging Het
Vmn1r204 T A 13: 22,557,078 I293N probably benign Het
Vmn2r84 A T 10: 130,389,268 C458S probably benign Het
Vmn2r85 T G 10: 130,425,919 H183P probably damaging Het
Vps13d G T 4: 145,105,861 T2825K probably benign Het
Zc3hc1 T A 6: 30,376,025 I179F probably benign Het
Zfp112 A G 7: 24,125,785 N393D probably damaging Het
Zfp558 A G 9: 18,456,563 S310P possibly damaging Het
Zfp560 A C 9: 20,348,775 probably null Het
Zfp668 C T 7: 127,867,080 E311K probably benign Het
Zfp763 T A 17: 33,033,302 M1L probably benign Het
Zfp947 A T 17: 22,145,832 M287K probably benign Het
Other mutations in Fcgbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Fcgbp APN 7 28085130 missense probably damaging 1.00
IGL00331:Fcgbp APN 7 28101541 splice site probably benign
IGL00335:Fcgbp APN 7 28086135 missense possibly damaging 0.90
IGL00470:Fcgbp APN 7 28075086 nonsense probably null
IGL00491:Fcgbp APN 7 28093402 missense probably damaging 1.00
IGL00498:Fcgbp APN 7 28091797 missense probably damaging 1.00
IGL01296:Fcgbp APN 7 28089647 missense probably benign 0.15
IGL01582:Fcgbp APN 7 28093642 missense probably benign 0.19
IGL01929:Fcgbp APN 7 28103963 missense probably damaging 1.00
IGL02024:Fcgbp APN 7 28106374 missense probably damaging 1.00
IGL02027:Fcgbp APN 7 28075204 missense probably damaging 1.00
IGL02140:Fcgbp APN 7 28091954 missense probably damaging 1.00
IGL02162:Fcgbp APN 7 28075235 missense probably damaging 1.00
IGL02345:Fcgbp APN 7 28071643 splice site probably benign
IGL02377:Fcgbp APN 7 28106970 missense possibly damaging 0.67
IGL02389:Fcgbp APN 7 28075171 missense probably damaging 1.00
IGL02423:Fcgbp APN 7 28089953 missense probably benign 0.02
IGL02523:Fcgbp APN 7 28104732 missense possibly damaging 0.89
IGL02561:Fcgbp APN 7 28101174 intron probably benign
IGL02631:Fcgbp APN 7 28085298 missense probably damaging 1.00
IGL02716:Fcgbp APN 7 28101434 missense probably damaging 0.98
IGL02836:Fcgbp APN 7 28117358 missense possibly damaging 0.91
IGL02957:Fcgbp APN 7 28091847 nonsense probably null
IGL02971:Fcgbp APN 7 28101473 missense probably damaging 1.00
IGL03284:Fcgbp APN 7 28085432 missense possibly damaging 0.93
IGL03379:Fcgbp APN 7 28089917 missense possibly damaging 0.76
IGL02796:Fcgbp UTSW 7 28101151 intron probably benign
PIT4486001:Fcgbp UTSW 7 28075273 missense possibly damaging 0.52
R0277:Fcgbp UTSW 7 28085493 critical splice donor site probably null
R0387:Fcgbp UTSW 7 28091454 splice site probably benign
R0586:Fcgbp UTSW 7 28089713 missense probably damaging 1.00
R0981:Fcgbp UTSW 7 28085110 nonsense probably null
R0987:Fcgbp UTSW 7 28094174 missense probably damaging 1.00
R1240:Fcgbp UTSW 7 28120525 missense probably damaging 1.00
R1394:Fcgbp UTSW 7 28093379 missense probably damaging 0.98
R1395:Fcgbp UTSW 7 28093379 missense probably damaging 0.98
R1438:Fcgbp UTSW 7 28103733 nonsense probably null
R1474:Fcgbp UTSW 7 28091848 missense probably benign 0.00
R1740:Fcgbp UTSW 7 28101249 missense possibly damaging 0.87
R1750:Fcgbp UTSW 7 28093443 nonsense probably null
R1772:Fcgbp UTSW 7 28105175 missense possibly damaging 0.90
R1804:Fcgbp UTSW 7 28086139 missense probably benign
R1808:Fcgbp UTSW 7 28085090 missense probably benign 0.04
R1819:Fcgbp UTSW 7 28085283 missense probably benign 0.00
R1934:Fcgbp UTSW 7 28107093 missense probably damaging 1.00
R1972:Fcgbp UTSW 7 28094192 missense probably benign 0.11
R2051:Fcgbp UTSW 7 28120360 missense probably damaging 0.97
R2072:Fcgbp UTSW 7 28120389 missense probably damaging 0.98
R2074:Fcgbp UTSW 7 28120389 missense probably damaging 0.98
R2124:Fcgbp UTSW 7 28092019 missense probably benign 0.03
R2155:Fcgbp UTSW 7 28107203 missense probably benign 0.00
R3015:Fcgbp UTSW 7 28075413 splice site probably benign
R3037:Fcgbp UTSW 7 28102702 missense possibly damaging 0.62
R3151:Fcgbp UTSW 7 28117240 missense probably damaging 1.00
R3176:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3177:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3276:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3277:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3623:Fcgbp UTSW 7 28101276 missense probably damaging 1.00
R3730:Fcgbp UTSW 7 28085457 missense possibly damaging 0.82
R3935:Fcgbp UTSW 7 28075399 missense probably benign 0.00
R3936:Fcgbp UTSW 7 28075399 missense probably benign 0.00
R4041:Fcgbp UTSW 7 28113979 missense probably benign 0.01
R4056:Fcgbp UTSW 7 28104116 missense probably benign 0.09
R4057:Fcgbp UTSW 7 28104116 missense probably benign 0.09
R4705:Fcgbp UTSW 7 28107296 missense probably benign 0.44
R4708:Fcgbp UTSW 7 28094961 missense probably benign 0.00
R4710:Fcgbp UTSW 7 28094961 missense probably benign 0.00
R4779:Fcgbp UTSW 7 28094937 missense probably damaging 1.00
R4820:Fcgbp UTSW 7 28113958 missense probably damaging 1.00
R4863:Fcgbp UTSW 7 28086344 missense probably benign 0.33
R4926:Fcgbp UTSW 7 28086235 missense probably damaging 0.99
R4947:Fcgbp UTSW 7 28089812 missense probably benign 0.00
R4979:Fcgbp UTSW 7 28117570 missense probably benign 0.06
R5002:Fcgbp UTSW 7 28086103 splice site probably null
R5219:Fcgbp UTSW 7 28104085 missense probably damaging 1.00
R5241:Fcgbp UTSW 7 28085199 missense probably damaging 1.00
R5301:Fcgbp UTSW 7 28093674 missense possibly damaging 0.93
R5306:Fcgbp UTSW 7 28091818 missense probably damaging 1.00
R5335:Fcgbp UTSW 7 28089734 missense probably damaging 1.00
R5399:Fcgbp UTSW 7 28105055 missense probably benign 0.05
R5418:Fcgbp UTSW 7 28085313 missense probably damaging 1.00
R5527:Fcgbp UTSW 7 28093635 missense probably benign
R5583:Fcgbp UTSW 7 28091579 missense probably damaging 1.00
R5698:Fcgbp UTSW 7 28092022 missense possibly damaging 0.95
R5780:Fcgbp UTSW 7 28085218 missense probably benign 0.02
R5813:Fcgbp UTSW 7 28101494 missense possibly damaging 0.64
R5910:Fcgbp UTSW 7 28085503 splice site probably benign
R5936:Fcgbp UTSW 7 28086692 missense probably damaging 0.98
R5992:Fcgbp UTSW 7 28120534 missense probably benign 0.05
R6091:Fcgbp UTSW 7 28104965 missense possibly damaging 0.90
R6372:Fcgbp UTSW 7 28107008 missense probably damaging 1.00
R6488:Fcgbp UTSW 7 28093538 missense probably damaging 0.96
R6548:Fcgbp UTSW 7 28091918 missense probably benign 0.00
R6553:Fcgbp UTSW 7 28113979 missense possibly damaging 0.79
R6585:Fcgbp UTSW 7 28113979 missense possibly damaging 0.79
R6695:Fcgbp UTSW 7 28086270 nonsense probably null
R6711:Fcgbp UTSW 7 28089673 missense probably damaging 0.99
R6803:Fcgbp UTSW 7 28103212 missense probably benign 0.00
R6822:Fcgbp UTSW 7 28107356 missense probably damaging 1.00
R6907:Fcgbp UTSW 7 28085018 missense probably damaging 1.00
R6912:Fcgbp UTSW 7 28089704 missense probably benign 0.15
R6924:Fcgbp UTSW 7 28093823 missense probably benign
R6943:Fcgbp UTSW 7 28092052 missense probably benign 0.22
R7060:Fcgbp UTSW 7 28091933 missense probably benign 0.20
R7103:Fcgbp UTSW 7 28084962 missense probably benign 0.00
R7208:Fcgbp UTSW 7 28104021 missense probably benign 0.01
R7291:Fcgbp UTSW 7 28101392 missense probably benign 0.00
R7301:Fcgbp UTSW 7 28093436 missense possibly damaging 0.65
R7404:Fcgbp UTSW 7 28101507 missense probably damaging 1.00
R7426:Fcgbp UTSW 7 28086524 missense probably benign 0.00
R7459:Fcgbp UTSW 7 28107285 missense possibly damaging 0.65
R7475:Fcgbp UTSW 7 28102976 missense probably damaging 0.99
R7505:Fcgbp UTSW 7 28089674 missense probably damaging 0.97
R7517:Fcgbp UTSW 7 28085369 missense probably damaging 1.00
R7519:Fcgbp UTSW 7 28086299 missense probably damaging 1.00
R7524:Fcgbp UTSW 7 28102966 missense probably damaging 1.00
R7649:Fcgbp UTSW 7 28091503 missense possibly damaging 0.88
R7782:Fcgbp UTSW 7 28085035 nonsense probably null
R7820:Fcgbp UTSW 7 28120359 missense probably benign 0.01
RF002:Fcgbp UTSW 7 28089755 missense probably benign
X0028:Fcgbp UTSW 7 28104020 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GCTTTCTCTGTGAGCCTGCAAACC -3'
(R):5'- TGTGACCAAGCCCACATAGGAGAC -3'

Sequencing Primer
(F):5'- GTTCTTGAGCCAACAGTGCATAG -3'
(R):5'- CCCACATAGGAGACTTGGC -3'
Posted On2014-04-13