Incidental Mutation 'R1521:Pkd1l2'
ID 166998
Institutional Source Beutler Lab
Gene Symbol Pkd1l2
Ensembl Gene ENSMUSG00000034416
Gene Name polycystic kidney disease 1 like 2
Synonyms 1700126L06Rik
MMRRC Submission 040870-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1521 (G1)
Quality Score 216
Status Not validated
Chromosome 8
Chromosomal Location 117722418-117809188 bp(-) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) T to C at 117792239 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098375] [ENSMUST00000109093]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000098375
SMART Domains Protein: ENSMUSP00000095977
Gene: ENSMUSG00000034416

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 1.8e-18 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 510 886 1.8e-13 PFAM
low complexity region 1050 1060 N/A INTRINSIC
GPS 1278 1327 1.61e-11 SMART
transmembrane domain 1346 1365 N/A INTRINSIC
LH2 1390 1509 6.05e-13 SMART
transmembrane domain 1552 1574 N/A INTRINSIC
transmembrane domain 1589 1611 N/A INTRINSIC
transmembrane domain 1815 1837 N/A INTRINSIC
transmembrane domain 1852 1874 N/A INTRINSIC
transmembrane domain 1940 1962 N/A INTRINSIC
Pfam:PKD_channel 1980 2403 6.4e-107 PFAM
Pfam:Ion_trans 2187 2396 2.5e-12 PFAM
low complexity region 2441 2458 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109093
SMART Domains Protein: ENSMUSP00000104721
Gene: ENSMUSG00000034416

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CLECT 26 152 1.56e-21 SMART
Pfam:Gal_Lectin 168 250 6.9e-19 PFAM
PKD 260 341 3.84e-1 SMART
low complexity region 496 507 N/A INTRINSIC
Pfam:REJ 519 883 7e-11 PFAM
low complexity region 1051 1061 N/A INTRINSIC
GPS 1279 1328 1.61e-11 SMART
transmembrane domain 1347 1366 N/A INTRINSIC
LH2 1391 1510 6.05e-13 SMART
transmembrane domain 1553 1575 N/A INTRINSIC
transmembrane domain 1590 1612 N/A INTRINSIC
transmembrane domain 1816 1838 N/A INTRINSIC
transmembrane domain 1853 1875 N/A INTRINSIC
transmembrane domain 1941 1963 N/A INTRINSIC
Pfam:PKD_channel 1981 2403 5.9e-106 PFAM
Pfam:Ion_trans 2138 2409 3.4e-12 PFAM
low complexity region 2442 2459 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. This gene appears to be a polymorphic pseudogene in humans, where some individuals contain a non-functional allele. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 112,713,867 (GRCm39) L104P possibly damaging Het
Adgrf5 T C 17: 43,741,443 (GRCm39) V360A probably benign Het
Ahnak G A 19: 8,982,092 (GRCm39) M1125I probably benign Het
Akap12 T C 10: 4,304,804 (GRCm39) V538A probably benign Het
Arhgef10l T C 4: 140,242,749 (GRCm39) D1088G possibly damaging Het
Atp7b A T 8: 22,517,689 (GRCm39) L268Q probably damaging Het
Atxn2 A C 5: 121,917,654 (GRCm39) N516T probably damaging Het
Cacna1h T C 17: 25,616,328 (GRCm39) M184V possibly damaging Het
Cacnb2 G T 2: 14,619,163 (GRCm39) R66L probably benign Het
Casp8ap2 A G 4: 32,631,867 (GRCm39) E96G probably damaging Het
Ccdc78 G T 17: 26,007,755 (GRCm39) R264L probably damaging Het
Cdh4 G A 2: 179,439,351 (GRCm39) R166H probably damaging Het
Cog7 C T 7: 121,529,797 (GRCm39) D615N possibly damaging Het
Crtc2 T C 3: 90,164,690 (GRCm39) V115A probably benign Het
Crybg1 A G 10: 43,874,412 (GRCm39) S899P probably damaging Het
Ctdnep1 T A 11: 69,879,461 (GRCm39) V128E probably damaging Het
Ctnna3 A G 10: 64,795,621 (GRCm39) K780E probably benign Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dazap2 T A 15: 100,515,946 (GRCm39) Y91* probably null Het
Dcdc5 T C 2: 106,182,014 (GRCm39) noncoding transcript Het
Dppa1 T A 11: 46,501,300 (GRCm39) R74S possibly damaging Het
Elovl1 A T 4: 118,289,197 (GRCm39) T241S probably benign Het
Eya1 G T 1: 14,344,774 (GRCm39) Q86K probably damaging Het
Fam110d T C 4: 133,978,661 (GRCm39) *272W probably null Het
Fancm A T 12: 65,168,478 (GRCm39) M1614L probably benign Het
Fcgbp C T 7: 27,774,585 (GRCm39) T53I probably benign Het
Fpr3 T A 17: 18,191,277 (GRCm39) W183R probably damaging Het
Galnt13 G A 2: 54,744,657 (GRCm39) V119I probably benign Het
Garin4 T A 1: 190,896,219 (GRCm39) R141S probably benign Het
Gcfc2 T C 6: 81,900,793 (GRCm39) S36P probably benign Het
Gdap2 T A 3: 100,101,931 (GRCm39) D412E possibly damaging Het
Gm12258 T C 11: 58,750,381 (GRCm39) C41R probably damaging Het
Hipk1 T G 3: 103,685,098 (GRCm39) E172D probably benign Het
Hmgcs1 T G 13: 120,165,127 (GRCm39) L326R probably benign Het
Hs6st1 C A 1: 36,107,967 (GRCm39) R77S probably damaging Het
Ifit3 A T 19: 34,564,573 (GRCm39) N40Y probably damaging Het
Il1a T A 2: 129,146,661 (GRCm39) Q144L possibly damaging Het
Itga7 A G 10: 128,793,680 (GRCm39) E1128G possibly damaging Het
Itih2 T C 2: 10,111,558 (GRCm39) D460G probably damaging Het
Ivns1abp G A 1: 151,227,309 (GRCm39) C39Y probably damaging Het
Kif22 G T 7: 126,627,011 (GRCm39) A646E probably damaging Het
Klhl29 T C 12: 5,141,307 (GRCm39) Y559C probably damaging Het
Klhl7 T A 5: 24,354,108 (GRCm39) probably null Het
Klhl9 A G 4: 88,640,230 (GRCm39) S4P probably benign Het
Klk10 A G 7: 43,432,304 (GRCm39) Q79R probably benign Het
Klk6 T C 7: 43,478,699 (GRCm39) probably null Het
Kpna2rt T A 17: 90,217,734 (GRCm39) N4I possibly damaging Het
Lamc2 C T 1: 153,042,009 (GRCm39) E42K probably benign Het
Lingo3 T C 10: 80,671,555 (GRCm39) D125G probably benign Het
Map1b T C 13: 99,569,247 (GRCm39) N1158S unknown Het
Masp1 T A 16: 23,313,387 (GRCm39) N183Y probably damaging Het
Mdga2 A G 12: 66,615,700 (GRCm39) Y636H probably benign Het
Mical2 T A 7: 111,980,817 (GRCm39) S264T probably damaging Het
Mif A G 10: 75,695,375 (GRCm39) V95A possibly damaging Het
Mmp17 G A 5: 129,672,152 (GRCm39) probably null Het
Mmp23 T C 4: 155,735,174 (GRCm39) R390G possibly damaging Het
Ncoa6 A C 2: 155,257,142 (GRCm39) S800R possibly damaging Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Nr2e3 A T 9: 59,856,488 (GRCm39) S67R probably damaging Het
Odf2l T C 3: 144,854,797 (GRCm39) S545P possibly damaging Het
Or10d3 A T 9: 39,462,080 (GRCm39) V29E possibly damaging Het
Or4a47 G A 2: 89,665,516 (GRCm39) R258* probably null Het
Or52s1b T A 7: 102,822,658 (GRCm39) Y62F probably benign Het
Or5k1b C T 16: 58,581,216 (GRCm39) E108K probably damaging Het
Or7e176 A C 9: 20,171,728 (GRCm39) Q197H possibly damaging Het
Or7g27 C T 9: 19,249,948 (GRCm39) S64F probably benign Het
Or8b51 T G 9: 38,569,014 (GRCm39) I225L probably damaging Het
Otog A T 7: 45,908,688 (GRCm39) H562L possibly damaging Het
Pcdh15 T C 10: 74,430,023 (GRCm39) V1250A probably damaging Het
Pde1c A G 6: 56,150,592 (GRCm39) V309A possibly damaging Het
Pfkfb4 A C 9: 108,836,373 (GRCm39) T134P probably damaging Het
Phc3 G T 3: 30,990,724 (GRCm39) Q498K possibly damaging Het
Phlpp1 T C 1: 106,320,049 (GRCm39) V1348A probably damaging Het
Pik3ap1 T C 19: 41,309,997 (GRCm39) D441G probably damaging Het
Pla2g4a T C 1: 149,733,437 (GRCm39) probably null Het
Pola2 A T 19: 5,998,434 (GRCm39) I376N probably damaging Het
Pold2 T A 11: 5,826,833 (GRCm39) N34Y probably damaging Het
Ppp2r5c T C 12: 110,521,320 (GRCm39) L281P probably damaging Het
Prss46 A G 9: 110,678,703 (GRCm39) I29V probably benign Het
Ranbp6 A T 19: 29,788,846 (GRCm39) V502E probably benign Het
Rdh14 T C 12: 10,444,613 (GRCm39) F155L probably damaging Het
Rnaseh2a A T 8: 85,692,487 (GRCm39) probably null Het
Rpp30 A G 19: 36,071,785 (GRCm39) T118A possibly damaging Het
Rragd T C 4: 32,996,005 (GRCm39) F117L probably damaging Het
Rxylt1 A G 10: 121,926,384 (GRCm39) W243R probably damaging Het
S100a2 T A 3: 90,498,599 (GRCm39) probably null Het
Septin12 T C 16: 4,814,340 (GRCm39) K43R probably damaging Het
Sh3tc2 A G 18: 62,141,559 (GRCm39) E1080G probably damaging Het
Slc26a9 A G 1: 131,678,415 (GRCm39) K27R probably damaging Het
Spata17 T A 1: 186,926,191 (GRCm39) K46N probably damaging Het
St14 A C 9: 31,019,511 (GRCm39) D103E probably benign Het
St6galnac2 T A 11: 116,575,173 (GRCm39) Q222L possibly damaging Het
Tdrd9 T C 12: 112,002,844 (GRCm39) V831A probably damaging Het
Tert A G 13: 73,790,175 (GRCm39) E843G probably damaging Het
Tex21 A G 12: 76,251,044 (GRCm39) V464A probably benign Het
Tmem232 T A 17: 65,791,496 (GRCm39) H124L probably damaging Het
Tnfrsf19 T G 14: 61,242,555 (GRCm39) S110R probably damaging Het
Tnnt3 A T 7: 142,069,562 (GRCm39) K272* probably null Het
Tnxb T C 17: 34,930,477 (GRCm39) L2054P probably damaging Het
Trcg1 A C 9: 57,149,748 (GRCm39) D440A probably benign Het
Trpm3 A G 19: 22,878,585 (GRCm39) E504G probably damaging Het
Trpm5 C T 7: 142,636,626 (GRCm39) R437H probably benign Het
Ttn T C 2: 76,571,511 (GRCm39) R18134G probably damaging Het
Uchl5 A C 1: 143,674,160 (GRCm39) M64L possibly damaging Het
Urb1 G A 16: 90,550,751 (GRCm39) R2034W probably damaging Het
Usp44 T A 10: 93,683,048 (GRCm39) C452* probably null Het
Uvssa G A 5: 33,571,278 (GRCm39) A641T probably damaging Het
Vmn1r204 T A 13: 22,741,248 (GRCm39) I293N probably benign Het
Vmn2r84 A T 10: 130,225,137 (GRCm39) C458S probably benign Het
Vmn2r85 T G 10: 130,261,788 (GRCm39) H183P probably damaging Het
Vps13d G T 4: 144,832,431 (GRCm39) T2825K probably benign Het
Zc3hc1 T A 6: 30,376,024 (GRCm39) I179F probably benign Het
Zfp112 A G 7: 23,825,210 (GRCm39) N393D probably damaging Het
Zfp558 A G 9: 18,367,859 (GRCm39) S310P possibly damaging Het
Zfp560 A C 9: 20,260,071 (GRCm39) probably null Het
Zfp668 C T 7: 127,466,252 (GRCm39) E311K probably benign Het
Zfp763 T A 17: 33,252,276 (GRCm39) M1L probably benign Het
Zfp947 A T 17: 22,364,813 (GRCm39) M287K probably benign Het
Other mutations in Pkd1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Pkd1l2 APN 8 117,786,259 (GRCm39) nonsense probably null
IGL01353:Pkd1l2 APN 8 117,784,182 (GRCm39) missense probably benign 0.24
IGL01362:Pkd1l2 APN 8 117,748,595 (GRCm39) missense probably damaging 1.00
IGL01486:Pkd1l2 APN 8 117,786,331 (GRCm39) missense probably benign
IGL01672:Pkd1l2 APN 8 117,807,471 (GRCm39) missense possibly damaging 0.94
IGL01696:Pkd1l2 APN 8 117,783,126 (GRCm39) missense probably benign 0.12
IGL01819:Pkd1l2 APN 8 117,724,913 (GRCm39) missense probably damaging 1.00
IGL01833:Pkd1l2 APN 8 117,787,264 (GRCm39) missense probably benign 0.00
IGL01981:Pkd1l2 APN 8 117,743,655 (GRCm39) missense probably benign 0.04
IGL02066:Pkd1l2 APN 8 117,736,303 (GRCm39) splice site probably benign
IGL02381:Pkd1l2 APN 8 117,762,539 (GRCm39) splice site probably benign
IGL02416:Pkd1l2 APN 8 117,767,574 (GRCm39) missense possibly damaging 0.82
IGL02736:Pkd1l2 APN 8 117,767,405 (GRCm39) missense probably benign 0.00
IGL02828:Pkd1l2 APN 8 117,756,298 (GRCm39) missense probably benign
IGL02861:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02862:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02883:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02884:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02894:Pkd1l2 APN 8 117,740,630 (GRCm39) missense probably damaging 0.97
IGL02900:Pkd1l2 APN 8 117,750,830 (GRCm39) missense probably benign 0.03
IGL02901:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02929:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02941:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02957:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL02969:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03028:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03059:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03065:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03066:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03083:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03084:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03124:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03162:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03165:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03335:Pkd1l2 APN 8 117,792,484 (GRCm39) missense probably benign 0.07
IGL03357:Pkd1l2 APN 8 117,722,548 (GRCm39) missense probably damaging 1.00
IGL02835:Pkd1l2 UTSW 8 117,792,484 (GRCm39) missense probably benign 0.07
PIT4453001:Pkd1l2 UTSW 8 117,748,761 (GRCm39) missense probably benign 0.00
R0127:Pkd1l2 UTSW 8 117,776,787 (GRCm39) splice site probably benign
R0309:Pkd1l2 UTSW 8 117,724,315 (GRCm39) missense probably damaging 0.99
R0365:Pkd1l2 UTSW 8 117,748,589 (GRCm39) missense probably benign 0.02
R0526:Pkd1l2 UTSW 8 117,808,999 (GRCm39) missense probably damaging 1.00
R0571:Pkd1l2 UTSW 8 117,808,957 (GRCm39) missense probably benign 0.01
R0716:Pkd1l2 UTSW 8 117,777,839 (GRCm39) missense probably damaging 1.00
R0787:Pkd1l2 UTSW 8 117,802,916 (GRCm39) missense possibly damaging 0.90
R0893:Pkd1l2 UTSW 8 117,771,231 (GRCm39) missense probably damaging 0.99
R1256:Pkd1l2 UTSW 8 117,746,282 (GRCm39) critical splice acceptor site probably null
R1391:Pkd1l2 UTSW 8 117,781,673 (GRCm39) missense possibly damaging 0.87
R1474:Pkd1l2 UTSW 8 117,792,236 (GRCm39) splice site probably benign
R1491:Pkd1l2 UTSW 8 117,755,147 (GRCm39) missense probably damaging 1.00
R1520:Pkd1l2 UTSW 8 117,772,898 (GRCm39) missense probably benign 0.00
R1544:Pkd1l2 UTSW 8 117,764,974 (GRCm39) frame shift probably null
R1558:Pkd1l2 UTSW 8 117,808,991 (GRCm39) missense possibly damaging 0.94
R1673:Pkd1l2 UTSW 8 117,767,514 (GRCm39) missense probably benign 0.00
R1691:Pkd1l2 UTSW 8 117,783,158 (GRCm39) missense possibly damaging 0.60
R1754:Pkd1l2 UTSW 8 117,757,458 (GRCm39) missense possibly damaging 0.81
R1857:Pkd1l2 UTSW 8 117,767,408 (GRCm39) missense possibly damaging 0.70
R1939:Pkd1l2 UTSW 8 117,772,921 (GRCm39) nonsense probably null
R1955:Pkd1l2 UTSW 8 117,770,100 (GRCm39) missense probably benign
R1957:Pkd1l2 UTSW 8 117,757,421 (GRCm39) missense probably damaging 1.00
R1959:Pkd1l2 UTSW 8 117,769,970 (GRCm39) critical splice donor site probably null
R2024:Pkd1l2 UTSW 8 117,746,272 (GRCm39) missense probably benign
R2046:Pkd1l2 UTSW 8 117,726,694 (GRCm39) missense probably damaging 1.00
R2102:Pkd1l2 UTSW 8 117,808,208 (GRCm39) missense probably damaging 0.98
R2116:Pkd1l2 UTSW 8 117,757,461 (GRCm39) missense possibly damaging 0.93
R2148:Pkd1l2 UTSW 8 117,783,064 (GRCm39) missense probably damaging 0.98
R2251:Pkd1l2 UTSW 8 117,784,177 (GRCm39) missense probably damaging 1.00
R2252:Pkd1l2 UTSW 8 117,784,177 (GRCm39) missense probably damaging 1.00
R2366:Pkd1l2 UTSW 8 117,770,056 (GRCm39) missense probably benign 0.01
R2566:Pkd1l2 UTSW 8 117,746,233 (GRCm39) missense probably damaging 1.00
R2872:Pkd1l2 UTSW 8 117,764,903 (GRCm39) missense probably benign 0.10
R2872:Pkd1l2 UTSW 8 117,764,903 (GRCm39) missense probably benign 0.10
R2985:Pkd1l2 UTSW 8 117,792,290 (GRCm39) missense probably benign 0.00
R3055:Pkd1l2 UTSW 8 117,795,054 (GRCm39) critical splice acceptor site probably null
R3436:Pkd1l2 UTSW 8 117,767,478 (GRCm39) missense probably benign 0.01
R4732:Pkd1l2 UTSW 8 117,722,581 (GRCm39) critical splice acceptor site probably null
R4733:Pkd1l2 UTSW 8 117,722,581 (GRCm39) critical splice acceptor site probably null
R4763:Pkd1l2 UTSW 8 117,746,168 (GRCm39) missense probably damaging 0.96
R4789:Pkd1l2 UTSW 8 117,738,314 (GRCm39) missense probably damaging 0.99
R4921:Pkd1l2 UTSW 8 117,781,624 (GRCm39) missense probably benign 0.03
R4921:Pkd1l2 UTSW 8 117,799,288 (GRCm39) missense probably damaging 0.97
R4999:Pkd1l2 UTSW 8 117,774,113 (GRCm39) splice site probably null
R5057:Pkd1l2 UTSW 8 117,781,747 (GRCm39) missense probably benign 0.21
R5209:Pkd1l2 UTSW 8 117,783,181 (GRCm39) missense probably benign 0.23
R5241:Pkd1l2 UTSW 8 117,761,857 (GRCm39) missense probably damaging 1.00
R5480:Pkd1l2 UTSW 8 117,757,388 (GRCm39) missense probably damaging 0.99
R5501:Pkd1l2 UTSW 8 117,792,569 (GRCm39) missense probably damaging 0.98
R5533:Pkd1l2 UTSW 8 117,794,855 (GRCm39) missense probably benign 0.03
R5582:Pkd1l2 UTSW 8 117,767,522 (GRCm39) nonsense probably null
R5610:Pkd1l2 UTSW 8 117,769,059 (GRCm39) missense probably benign 0.04
R5770:Pkd1l2 UTSW 8 117,781,757 (GRCm39) missense probably damaging 1.00
R5854:Pkd1l2 UTSW 8 117,792,485 (GRCm39) missense possibly damaging 0.48
R5867:Pkd1l2 UTSW 8 117,781,750 (GRCm39) missense probably damaging 0.96
R5881:Pkd1l2 UTSW 8 117,724,321 (GRCm39) missense probably damaging 0.99
R5906:Pkd1l2 UTSW 8 117,756,387 (GRCm39) missense probably damaging 1.00
R5909:Pkd1l2 UTSW 8 117,750,795 (GRCm39) missense probably benign 0.00
R6030:Pkd1l2 UTSW 8 117,769,976 (GRCm39) missense probably damaging 1.00
R6030:Pkd1l2 UTSW 8 117,769,976 (GRCm39) missense probably damaging 1.00
R6084:Pkd1l2 UTSW 8 117,740,726 (GRCm39) missense probably damaging 1.00
R6122:Pkd1l2 UTSW 8 117,809,107 (GRCm39) missense probably benign 0.02
R6216:Pkd1l2 UTSW 8 117,808,209 (GRCm39) missense probably damaging 1.00
R6406:Pkd1l2 UTSW 8 117,762,586 (GRCm39) missense probably damaging 0.99
R6417:Pkd1l2 UTSW 8 117,740,638 (GRCm39) missense probably damaging 1.00
R6420:Pkd1l2 UTSW 8 117,740,638 (GRCm39) missense probably damaging 1.00
R6601:Pkd1l2 UTSW 8 117,767,405 (GRCm39) missense probably benign 0.00
R6743:Pkd1l2 UTSW 8 117,757,370 (GRCm39) missense probably damaging 1.00
R7053:Pkd1l2 UTSW 8 117,740,681 (GRCm39) missense probably damaging 1.00
R7144:Pkd1l2 UTSW 8 117,802,870 (GRCm39) nonsense probably null
R7148:Pkd1l2 UTSW 8 117,807,525 (GRCm39) missense probably benign 0.00
R7169:Pkd1l2 UTSW 8 117,767,574 (GRCm39) missense possibly damaging 0.82
R7217:Pkd1l2 UTSW 8 117,722,536 (GRCm39) missense probably benign 0.24
R7310:Pkd1l2 UTSW 8 117,750,773 (GRCm39) missense probably benign
R7382:Pkd1l2 UTSW 8 117,781,610 (GRCm39) missense possibly damaging 0.95
R7397:Pkd1l2 UTSW 8 117,762,641 (GRCm39) missense possibly damaging 0.94
R7408:Pkd1l2 UTSW 8 117,755,218 (GRCm39) missense possibly damaging 0.77
R7437:Pkd1l2 UTSW 8 117,757,421 (GRCm39) missense probably damaging 0.96
R7492:Pkd1l2 UTSW 8 117,794,849 (GRCm39) missense probably damaging 1.00
R7496:Pkd1l2 UTSW 8 117,787,333 (GRCm39) missense possibly damaging 0.89
R7519:Pkd1l2 UTSW 8 117,792,268 (GRCm39) missense probably benign
R7590:Pkd1l2 UTSW 8 117,807,525 (GRCm39) missense probably benign 0.00
R7623:Pkd1l2 UTSW 8 117,756,384 (GRCm39) missense probably damaging 1.00
R7768:Pkd1l2 UTSW 8 117,781,599 (GRCm39) critical splice donor site probably null
R7897:Pkd1l2 UTSW 8 117,724,827 (GRCm39) missense possibly damaging 0.69
R7982:Pkd1l2 UTSW 8 117,777,926 (GRCm39) missense possibly damaging 0.70
R8024:Pkd1l2 UTSW 8 117,802,921 (GRCm39) missense possibly damaging 0.85
R8140:Pkd1l2 UTSW 8 117,774,236 (GRCm39) missense probably benign
R8145:Pkd1l2 UTSW 8 117,781,742 (GRCm39) missense probably benign
R8228:Pkd1l2 UTSW 8 117,792,514 (GRCm39) missense probably damaging 0.97
R8252:Pkd1l2 UTSW 8 117,767,472 (GRCm39) missense probably benign 0.29
R8500:Pkd1l2 UTSW 8 117,774,302 (GRCm39) critical splice acceptor site probably null
R8732:Pkd1l2 UTSW 8 117,792,311 (GRCm39) missense probably benign 0.28
R8809:Pkd1l2 UTSW 8 117,726,660 (GRCm39) missense probably damaging 1.00
R8896:Pkd1l2 UTSW 8 117,740,615 (GRCm39) missense possibly damaging 0.91
R8961:Pkd1l2 UTSW 8 117,726,717 (GRCm39) missense possibly damaging 0.52
R8985:Pkd1l2 UTSW 8 117,764,849 (GRCm39) missense probably benign 0.01
R9008:Pkd1l2 UTSW 8 117,769,037 (GRCm39) missense probably benign 0.32
R9091:Pkd1l2 UTSW 8 117,759,433 (GRCm39) missense probably damaging 1.00
R9138:Pkd1l2 UTSW 8 117,781,748 (GRCm39) missense probably benign 0.43
R9160:Pkd1l2 UTSW 8 117,767,408 (GRCm39) missense possibly damaging 0.70
R9249:Pkd1l2 UTSW 8 117,746,159 (GRCm39) missense probably damaging 0.99
R9270:Pkd1l2 UTSW 8 117,759,433 (GRCm39) missense probably damaging 1.00
R9735:Pkd1l2 UTSW 8 117,772,820 (GRCm39) missense possibly damaging 0.94
Z1176:Pkd1l2 UTSW 8 117,781,653 (GRCm39) missense probably damaging 1.00
Z1177:Pkd1l2 UTSW 8 117,757,430 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATTAGGACCACGCTGGAGGAG -3'
(R):5'- CAAGCTGTCAGCAATGAAGGCAC -3'

Sequencing Primer
(F):5'- TTAGCAAAGCCCCAGTGG -3'
(R):5'- CTGGAAACTTCACTGTGTACTTTG -3'
Posted On 2014-04-13