Incidental Mutation 'R1521:Trcg1'
ID 167006
Institutional Source Beutler Lab
Gene Symbol Trcg1
Ensembl Gene ENSMUSG00000070298
Gene Name taste receptor cell gene 1
Synonyms
MMRRC Submission 040870-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R1521 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 57236556-57249864 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 57242465 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 440 (D440A)
Ref Sequence ENSEMBL: ENSMUSP00000091357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093837]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000093837
AA Change: D440A

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000091357
Gene: ENSMUSG00000070298
AA Change: D440A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 302 335 N/A INTRINSIC
Blast:SEA 449 549 5e-21 BLAST
low complexity region 580 594 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 111,987,235 (GRCm38) L104P possibly damaging Het
Adgrf5 T C 17: 43,430,552 (GRCm38) V360A probably benign Het
Ahnak G A 19: 9,004,728 (GRCm38) M1125I probably benign Het
Akap12 T C 10: 4,354,804 (GRCm38) V538A probably benign Het
Arhgef10l T C 4: 140,515,438 (GRCm38) D1088G possibly damaging Het
Atp7b A T 8: 22,027,673 (GRCm38) L268Q probably damaging Het
Atxn2 A C 5: 121,779,591 (GRCm38) N516T probably damaging Het
Cacna1h T C 17: 25,397,354 (GRCm38) M184V possibly damaging Het
Cacnb2 G T 2: 14,614,352 (GRCm38) R66L probably benign Het
Casp8ap2 A G 4: 32,631,867 (GRCm38) E96G probably damaging Het
Ccdc78 G T 17: 25,788,781 (GRCm38) R264L probably damaging Het
Cdh4 G A 2: 179,797,558 (GRCm38) R166H probably damaging Het
Cog7 C T 7: 121,930,574 (GRCm38) D615N possibly damaging Het
Crtc2 T C 3: 90,257,383 (GRCm38) V115A probably benign Het
Crybg1 A G 10: 43,998,416 (GRCm38) S899P probably damaging Het
Ctdnep1 T A 11: 69,988,635 (GRCm38) V128E probably damaging Het
Ctnna3 A G 10: 64,959,842 (GRCm38) K780E probably benign Het
Cul7 T A 17: 46,663,190 (GRCm38) L1467H probably damaging Het
Dazap2 T A 15: 100,618,065 (GRCm38) Y91* probably null Het
Dcdc5 T C 2: 106,351,669 (GRCm38) noncoding transcript Het
Dppa1 T A 11: 46,610,473 (GRCm38) R74S possibly damaging Het
Elovl1 A T 4: 118,432,000 (GRCm38) T241S probably benign Het
Eya1 G T 1: 14,274,550 (GRCm38) Q86K probably damaging Het
Fam71a T A 1: 191,164,022 (GRCm38) R141S probably benign Het
Fancm A T 12: 65,121,704 (GRCm38) M1614L probably benign Het
Fcgbp C T 7: 28,075,160 (GRCm38) T53I probably benign Het
Fpr3 T A 17: 17,971,015 (GRCm38) W183R probably damaging Het
Galnt13 G A 2: 54,854,645 (GRCm38) V119I probably benign Het
Gcfc2 T C 6: 81,923,812 (GRCm38) S36P probably benign Het
Gdap2 T A 3: 100,194,615 (GRCm38) D412E possibly damaging Het
Gm10184 T A 17: 89,910,306 (GRCm38) N4I possibly damaging Het
Gm12258 T C 11: 58,859,555 (GRCm38) C41R probably damaging Het
Grrp1 T C 4: 134,251,350 (GRCm38) *272W probably null Het
Hipk1 T G 3: 103,777,782 (GRCm38) E172D probably benign Het
Hmgcs1 T G 13: 119,703,591 (GRCm38) L326R probably benign Het
Hs6st1 C A 1: 36,068,886 (GRCm38) R77S probably damaging Het
Ifit3 A T 19: 34,587,173 (GRCm38) N40Y probably damaging Het
Il1a T A 2: 129,304,741 (GRCm38) Q144L possibly damaging Het
Itga7 A G 10: 128,957,811 (GRCm38) E1128G possibly damaging Het
Itih2 T C 2: 10,106,747 (GRCm38) D460G probably damaging Het
Ivns1abp G A 1: 151,351,558 (GRCm38) C39Y probably damaging Het
Kif22 G T 7: 127,027,839 (GRCm38) A646E probably damaging Het
Klhl29 T C 12: 5,091,307 (GRCm38) Y559C probably damaging Het
Klhl7 T A 5: 24,149,110 (GRCm38) probably null Het
Klhl9 A G 4: 88,721,993 (GRCm38) S4P probably benign Het
Klk10 A G 7: 43,782,880 (GRCm38) Q79R probably benign Het
Klk6 T C 7: 43,829,275 (GRCm38) probably null Het
Lamc2 C T 1: 153,166,263 (GRCm38) E42K probably benign Het
Lingo3 T C 10: 80,835,721 (GRCm38) D125G probably benign Het
Map1b T C 13: 99,432,739 (GRCm38) N1158S unknown Het
Masp1 T A 16: 23,494,637 (GRCm38) N183Y probably damaging Het
Mdga2 A G 12: 66,568,926 (GRCm38) Y636H probably benign Het
Micalcl T A 7: 112,381,610 (GRCm38) S264T probably damaging Het
Mif A G 10: 75,859,541 (GRCm38) V95A possibly damaging Het
Mmp17 G A 5: 129,595,088 (GRCm38) probably null Het
Mmp23 T C 4: 155,650,717 (GRCm38) R390G possibly damaging Het
Ncoa6 A C 2: 155,415,222 (GRCm38) S800R possibly damaging Het
Nfix G A 8: 84,726,526 (GRCm38) R300C probably damaging Het
Nr2e3 A T 9: 59,949,205 (GRCm38) S67R probably damaging Het
Odf2l T C 3: 145,149,036 (GRCm38) S545P possibly damaging Het
Olfr1256 G A 2: 89,835,172 (GRCm38) R258* probably null Het
Olfr172 C T 16: 58,760,853 (GRCm38) E108K probably damaging Het
Olfr591 T A 7: 103,173,451 (GRCm38) Y62F probably benign Het
Olfr845 C T 9: 19,338,652 (GRCm38) S64F probably benign Het
Olfr872 A C 9: 20,260,432 (GRCm38) Q197H possibly damaging Het
Olfr916 T G 9: 38,657,718 (GRCm38) I225L probably damaging Het
Olfr958 A T 9: 39,550,784 (GRCm38) V29E possibly damaging Het
Otog A T 7: 46,259,264 (GRCm38) H562L possibly damaging Het
Pcdh15 T C 10: 74,594,191 (GRCm38) V1250A probably damaging Het
Pde1c A G 6: 56,173,607 (GRCm38) V309A possibly damaging Het
Pfkfb4 A C 9: 109,007,305 (GRCm38) T134P probably damaging Het
Phc3 G T 3: 30,936,575 (GRCm38) Q498K possibly damaging Het
Phlpp1 T C 1: 106,392,319 (GRCm38) V1348A probably damaging Het
Pik3ap1 T C 19: 41,321,558 (GRCm38) D441G probably damaging Het
Pkd1l2 T C 8: 117,065,500 (GRCm38) probably null Het
Pla2g4a T C 1: 149,857,686 (GRCm38) probably null Het
Pola2 A T 19: 5,948,406 (GRCm38) I376N probably damaging Het
Pold2 T A 11: 5,876,833 (GRCm38) N34Y probably damaging Het
Ppp2r5c T C 12: 110,554,886 (GRCm38) L281P probably damaging Het
Prss46 A G 9: 110,849,635 (GRCm38) I29V probably benign Het
Ranbp6 A T 19: 29,811,446 (GRCm38) V502E probably benign Het
Rdh14 T C 12: 10,394,613 (GRCm38) F155L probably damaging Het
Rnaseh2a A T 8: 84,965,858 (GRCm38) probably null Het
Rpp30 A G 19: 36,094,385 (GRCm38) T118A possibly damaging Het
Rragd T C 4: 32,996,005 (GRCm38) F117L probably damaging Het
S100a2 T A 3: 90,591,292 (GRCm38) probably null Het
Sept12 T C 16: 4,996,476 (GRCm38) K43R probably damaging Het
Sh3tc2 A G 18: 62,008,488 (GRCm38) E1080G probably damaging Het
Slc26a9 A G 1: 131,750,677 (GRCm38) K27R probably damaging Het
Spata17 T A 1: 187,193,994 (GRCm38) K46N probably damaging Het
St14 A C 9: 31,108,215 (GRCm38) D103E probably benign Het
St6galnac2 T A 11: 116,684,347 (GRCm38) Q222L possibly damaging Het
Tdrd9 T C 12: 112,036,410 (GRCm38) V831A probably damaging Het
Tert A G 13: 73,642,056 (GRCm38) E843G probably damaging Het
Tex21 A G 12: 76,204,270 (GRCm38) V464A probably benign Het
Tmem232 T A 17: 65,484,501 (GRCm38) H124L probably damaging Het
Tmem5 A G 10: 122,090,479 (GRCm38) W243R probably damaging Het
Tnfrsf19 T G 14: 61,005,106 (GRCm38) S110R probably damaging Het
Tnnt3 A T 7: 142,515,825 (GRCm38) K272* probably null Het
Tnxb T C 17: 34,711,503 (GRCm38) L2054P probably damaging Het
Trpm3 A G 19: 22,901,221 (GRCm38) E504G probably damaging Het
Trpm5 C T 7: 143,082,889 (GRCm38) R437H probably benign Het
Ttn T C 2: 76,741,167 (GRCm38) R18134G probably damaging Het
Uchl5 A C 1: 143,798,422 (GRCm38) M64L possibly damaging Het
Urb1 G A 16: 90,753,863 (GRCm38) R2034W probably damaging Het
Usp44 T A 10: 93,847,186 (GRCm38) C452* probably null Het
Uvssa G A 5: 33,413,934 (GRCm38) A641T probably damaging Het
Vmn1r204 T A 13: 22,557,078 (GRCm38) I293N probably benign Het
Vmn2r84 A T 10: 130,389,268 (GRCm38) C458S probably benign Het
Vmn2r85 T G 10: 130,425,919 (GRCm38) H183P probably damaging Het
Vps13d G T 4: 145,105,861 (GRCm38) T2825K probably benign Het
Zc3hc1 T A 6: 30,376,025 (GRCm38) I179F probably benign Het
Zfp112 A G 7: 24,125,785 (GRCm38) N393D probably damaging Het
Zfp558 A G 9: 18,456,563 (GRCm38) S310P possibly damaging Het
Zfp560 A C 9: 20,348,775 (GRCm38) probably null Het
Zfp668 C T 7: 127,867,080 (GRCm38) E311K probably benign Het
Zfp763 T A 17: 33,033,302 (GRCm38) M1L probably benign Het
Zfp947 A T 17: 22,145,832 (GRCm38) M287K probably benign Het
Other mutations in Trcg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01727:Trcg1 APN 9 57,242,594 (GRCm38) missense probably damaging 0.97
IGL01727:Trcg1 APN 9 57,242,273 (GRCm38) missense probably benign
IGL02147:Trcg1 APN 9 57,245,849 (GRCm38) missense probably benign 0.20
IGL02329:Trcg1 APN 9 57,240,393 (GRCm38) missense possibly damaging 0.92
IGL02658:Trcg1 APN 9 57,242,228 (GRCm38) nonsense probably null
IGL02852:Trcg1 APN 9 57,241,312 (GRCm38) missense possibly damaging 0.94
IGL03163:Trcg1 APN 9 57,248,347 (GRCm38) missense possibly damaging 0.92
FR4589:Trcg1 UTSW 9 57,242,202 (GRCm38) frame shift probably null
R0555:Trcg1 UTSW 9 57,242,333 (GRCm38) missense probably damaging 1.00
R0747:Trcg1 UTSW 9 57,241,921 (GRCm38) missense probably benign 0.00
R1061:Trcg1 UTSW 9 57,245,873 (GRCm38) missense possibly damaging 0.66
R1622:Trcg1 UTSW 9 57,248,672 (GRCm38) missense possibly damaging 0.94
R1652:Trcg1 UTSW 9 57,245,573 (GRCm38) missense probably damaging 0.99
R4677:Trcg1 UTSW 9 57,245,861 (GRCm38) missense possibly damaging 0.94
R4879:Trcg1 UTSW 9 57,246,720 (GRCm38) missense probably damaging 0.99
R5013:Trcg1 UTSW 9 57,242,279 (GRCm38) missense probably damaging 0.99
R5141:Trcg1 UTSW 9 57,241,304 (GRCm38) missense probably damaging 1.00
R5690:Trcg1 UTSW 9 57,241,811 (GRCm38) missense probably benign 0.36
R6416:Trcg1 UTSW 9 57,241,330 (GRCm38) missense possibly damaging 0.46
R6980:Trcg1 UTSW 9 57,245,573 (GRCm38) missense probably damaging 0.99
R7022:Trcg1 UTSW 9 57,241,569 (GRCm38) missense possibly damaging 0.46
R7172:Trcg1 UTSW 9 57,248,335 (GRCm38) missense probably benign 0.01
R7276:Trcg1 UTSW 9 57,242,579 (GRCm38) missense probably damaging 0.99
R7412:Trcg1 UTSW 9 57,241,483 (GRCm38) missense probably benign 0.00
R7546:Trcg1 UTSW 9 57,248,338 (GRCm38) missense probably benign 0.34
R7942:Trcg1 UTSW 9 57,242,216 (GRCm38) missense probably benign
R8087:Trcg1 UTSW 9 57,248,674 (GRCm38) missense probably damaging 0.99
R8094:Trcg1 UTSW 9 57,242,281 (GRCm38) missense probably benign 0.01
R8825:Trcg1 UTSW 9 57,241,471 (GRCm38) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AGCCAGTGACTCTCCTAAAGCTCC -3'
(R):5'- GTGCCACACCTGGTAGCAGATAAG -3'

Sequencing Primer
(F):5'- ACCTAGTCACCCTGGGCTATG -3'
(R):5'- CCTGGTAGCAGATAAGCCTGTTC -3'
Posted On 2014-04-13