Incidental Mutation 'R1521:Vmn2r84'
Institutional Source Beutler Lab
Gene Symbol Vmn2r84
Ensembl Gene ENSMUSG00000070601
Gene Namevomeronasal 2, receptor 84
MMRRC Submission 040870-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1521 (G1)
Quality Score225
Status Not validated
Chromosomal Location130385316-130394241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130389268 bp
Amino Acid Change Cysteine to Serine at position 458 (C458S)
Ref Sequence ENSEMBL: ENSMUSP00000092079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094502]
Predicted Effect probably benign
Transcript: ENSMUST00000094502
AA Change: C458S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000092079
Gene: ENSMUSG00000070601
AA Change: C458S

signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 77 448 1.3e-27 PFAM
Pfam:NCD3G 508 561 6.9e-21 PFAM
Pfam:7tm_3 594 830 4.6e-55 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 111,987,235 L104P possibly damaging Het
Adgrf5 T C 17: 43,430,552 V360A probably benign Het
Ahnak G A 19: 9,004,728 M1125I probably benign Het
Akap12 T C 10: 4,354,804 V538A probably benign Het
Arhgef10l T C 4: 140,515,438 D1088G possibly damaging Het
Atp7b A T 8: 22,027,673 L268Q probably damaging Het
Atxn2 A C 5: 121,779,591 N516T probably damaging Het
Cacna1h T C 17: 25,397,354 M184V possibly damaging Het
Cacnb2 G T 2: 14,614,352 R66L probably benign Het
Casp8ap2 A G 4: 32,631,867 E96G probably damaging Het
Ccdc78 G T 17: 25,788,781 R264L probably damaging Het
Cdh4 G A 2: 179,797,558 R166H probably damaging Het
Cog7 C T 7: 121,930,574 D615N possibly damaging Het
Crtc2 T C 3: 90,257,383 V115A probably benign Het
Crybg1 A G 10: 43,998,416 S899P probably damaging Het
Ctdnep1 T A 11: 69,988,635 V128E probably damaging Het
Ctnna3 A G 10: 64,959,842 K780E probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dazap2 T A 15: 100,618,065 Y91* probably null Het
Dcdc5 T C 2: 106,351,669 noncoding transcript Het
Dppa1 T A 11: 46,610,473 R74S possibly damaging Het
Elovl1 A T 4: 118,432,000 T241S probably benign Het
Eya1 G T 1: 14,274,550 Q86K probably damaging Het
Fam71a T A 1: 191,164,022 R141S probably benign Het
Fancm A T 12: 65,121,704 M1614L probably benign Het
Fcgbp C T 7: 28,075,160 T53I probably benign Het
Fpr3 T A 17: 17,971,015 W183R probably damaging Het
Galnt13 G A 2: 54,854,645 V119I probably benign Het
Gcfc2 T C 6: 81,923,812 S36P probably benign Het
Gdap2 T A 3: 100,194,615 D412E possibly damaging Het
Gm10184 T A 17: 89,910,306 N4I possibly damaging Het
Gm12258 T C 11: 58,859,555 C41R probably damaging Het
Grrp1 T C 4: 134,251,350 *272W probably null Het
Hipk1 T G 3: 103,777,782 E172D probably benign Het
Hmgcs1 T G 13: 119,703,591 L326R probably benign Het
Hs6st1 C A 1: 36,068,886 R77S probably damaging Het
Ifit3 A T 19: 34,587,173 N40Y probably damaging Het
Il1a T A 2: 129,304,741 Q144L possibly damaging Het
Itga7 A G 10: 128,957,811 E1128G possibly damaging Het
Itih2 T C 2: 10,106,747 D460G probably damaging Het
Ivns1abp G A 1: 151,351,558 C39Y probably damaging Het
Kif22 G T 7: 127,027,839 A646E probably damaging Het
Klhl29 T C 12: 5,091,307 Y559C probably damaging Het
Klhl7 T A 5: 24,149,110 probably null Het
Klhl9 A G 4: 88,721,993 S4P probably benign Het
Klk10 A G 7: 43,782,880 Q79R probably benign Het
Klk6 T C 7: 43,829,275 probably null Het
Lamc2 C T 1: 153,166,263 E42K probably benign Het
Lingo3 T C 10: 80,835,721 D125G probably benign Het
Map1b T C 13: 99,432,739 N1158S unknown Het
Masp1 T A 16: 23,494,637 N183Y probably damaging Het
Mdga2 A G 12: 66,568,926 Y636H probably benign Het
Micalcl T A 7: 112,381,610 S264T probably damaging Het
Mif A G 10: 75,859,541 V95A possibly damaging Het
Mmp17 G A 5: 129,595,088 probably null Het
Mmp23 T C 4: 155,650,717 R390G possibly damaging Het
Ncoa6 A C 2: 155,415,222 S800R possibly damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Nr2e3 A T 9: 59,949,205 S67R probably damaging Het
Odf2l T C 3: 145,149,036 S545P possibly damaging Het
Olfr1256 G A 2: 89,835,172 R258* probably null Het
Olfr172 C T 16: 58,760,853 E108K probably damaging Het
Olfr591 T A 7: 103,173,451 Y62F probably benign Het
Olfr845 C T 9: 19,338,652 S64F probably benign Het
Olfr872 A C 9: 20,260,432 Q197H possibly damaging Het
Olfr916 T G 9: 38,657,718 I225L probably damaging Het
Olfr958 A T 9: 39,550,784 V29E possibly damaging Het
Otog A T 7: 46,259,264 H562L possibly damaging Het
Pcdh15 T C 10: 74,594,191 V1250A probably damaging Het
Pde1c A G 6: 56,173,607 V309A possibly damaging Het
Pfkfb4 A C 9: 109,007,305 T134P probably damaging Het
Phc3 G T 3: 30,936,575 Q498K possibly damaging Het
Phlpp1 T C 1: 106,392,319 V1348A probably damaging Het
Pik3ap1 T C 19: 41,321,558 D441G probably damaging Het
Pkd1l2 T C 8: 117,065,500 probably null Het
Pla2g4a T C 1: 149,857,686 probably null Het
Pola2 A T 19: 5,948,406 I376N probably damaging Het
Pold2 T A 11: 5,876,833 N34Y probably damaging Het
Ppp2r5c T C 12: 110,554,886 L281P probably damaging Het
Prss46 A G 9: 110,849,635 I29V probably benign Het
Ranbp6 A T 19: 29,811,446 V502E probably benign Het
Rdh14 T C 12: 10,394,613 F155L probably damaging Het
Rnaseh2a A T 8: 84,965,858 probably null Het
Rpp30 A G 19: 36,094,385 T118A possibly damaging Het
Rragd T C 4: 32,996,005 F117L probably damaging Het
S100a2 T A 3: 90,591,292 probably null Het
Sept12 T C 16: 4,996,476 K43R probably damaging Het
Sh3tc2 A G 18: 62,008,488 E1080G probably damaging Het
Slc26a9 A G 1: 131,750,677 K27R probably damaging Het
Spata17 T A 1: 187,193,994 K46N probably damaging Het
St14 A C 9: 31,108,215 D103E probably benign Het
St6galnac2 T A 11: 116,684,347 Q222L possibly damaging Het
Tdrd9 T C 12: 112,036,410 V831A probably damaging Het
Tert A G 13: 73,642,056 E843G probably damaging Het
Tex21 A G 12: 76,204,270 V464A probably benign Het
Tmem232 T A 17: 65,484,501 H124L probably damaging Het
Tmem5 A G 10: 122,090,479 W243R probably damaging Het
Tnfrsf19 T G 14: 61,005,106 S110R probably damaging Het
Tnnt3 A T 7: 142,515,825 K272* probably null Het
Tnxb T C 17: 34,711,503 L2054P probably damaging Het
Trcg1 A C 9: 57,242,465 D440A probably benign Het
Trpm3 A G 19: 22,901,221 E504G probably damaging Het
Trpm5 C T 7: 143,082,889 R437H probably benign Het
Ttn T C 2: 76,741,167 R18134G probably damaging Het
Uchl5 A C 1: 143,798,422 M64L possibly damaging Het
Urb1 G A 16: 90,753,863 R2034W probably damaging Het
Usp44 T A 10: 93,847,186 C452* probably null Het
Uvssa G A 5: 33,413,934 A641T probably damaging Het
Vmn1r204 T A 13: 22,557,078 I293N probably benign Het
Vmn2r85 T G 10: 130,425,919 H183P probably damaging Het
Vps13d G T 4: 145,105,861 T2825K probably benign Het
Zc3hc1 T A 6: 30,376,025 I179F probably benign Het
Zfp112 A G 7: 24,125,785 N393D probably damaging Het
Zfp558 A G 9: 18,456,563 S310P possibly damaging Het
Zfp560 A C 9: 20,348,775 probably null Het
Zfp668 C T 7: 127,867,080 E311K probably benign Het
Zfp763 T A 17: 33,033,302 M1L probably benign Het
Zfp947 A T 17: 22,145,832 M287K probably benign Het
Other mutations in Vmn2r84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Vmn2r84 APN 10 130391225 missense possibly damaging 0.65
IGL01590:Vmn2r84 APN 10 130386095 missense probably damaging 1.00
IGL01639:Vmn2r84 APN 10 130389272 nonsense probably null
IGL01843:Vmn2r84 APN 10 130386279 missense probably benign
IGL01911:Vmn2r84 APN 10 130386408 missense probably damaging 0.99
IGL01937:Vmn2r84 APN 10 130385886 missense probably damaging 1.00
IGL01977:Vmn2r84 APN 10 130394066 missense probably benign 0.11
IGL02177:Vmn2r84 APN 10 130392012 missense probably benign 0.00
IGL02291:Vmn2r84 APN 10 130390748 missense probably damaging 1.00
IGL02590:Vmn2r84 APN 10 130391487 splice site probably benign
IGL02727:Vmn2r84 APN 10 130394126 missense possibly damaging 0.95
IGL02900:Vmn2r84 APN 10 130387992 splice site probably benign
IGL03383:Vmn2r84 APN 10 130386687 missense probably damaging 1.00
PIT4378001:Vmn2r84 UTSW 10 130385915 missense probably damaging 1.00
R0076:Vmn2r84 UTSW 10 130394193 missense probably damaging 1.00
R0089:Vmn2r84 UTSW 10 130386719 splice site probably benign
R0153:Vmn2r84 UTSW 10 130392008 missense probably benign 0.06
R0611:Vmn2r84 UTSW 10 130386122 missense probably damaging 1.00
R0883:Vmn2r84 UTSW 10 130391115 missense probably damaging 0.99
R1237:Vmn2r84 UTSW 10 130387856 splice site probably null
R1295:Vmn2r84 UTSW 10 130389139 missense probably benign 0.12
R1401:Vmn2r84 UTSW 10 130391990 missense possibly damaging 0.89
R1590:Vmn2r84 UTSW 10 130391480 critical splice acceptor site probably null
R1710:Vmn2r84 UTSW 10 130391099 missense probably benign 0.02
R1891:Vmn2r84 UTSW 10 130386069 missense possibly damaging 0.78
R1956:Vmn2r84 UTSW 10 130390808 missense probably benign 0.01
R1957:Vmn2r84 UTSW 10 130390808 missense probably benign 0.01
R1962:Vmn2r84 UTSW 10 130390722 missense probably damaging 0.99
R1994:Vmn2r84 UTSW 10 130386009 missense probably damaging 1.00
R2124:Vmn2r84 UTSW 10 130391231 missense probably damaging 0.99
R2409:Vmn2r84 UTSW 10 130392071 missense probably damaging 0.99
R2474:Vmn2r84 UTSW 10 130386523 missense possibly damaging 0.50
R2851:Vmn2r84 UTSW 10 130394167 missense probably benign 0.05
R3508:Vmn2r84 UTSW 10 130390908 missense probably damaging 1.00
R3792:Vmn2r84 UTSW 10 130385800 makesense probably null
R4051:Vmn2r84 UTSW 10 130390898 missense probably damaging 1.00
R4061:Vmn2r84 UTSW 10 130386029 missense probably damaging 1.00
R4091:Vmn2r84 UTSW 10 130391369 missense probably damaging 1.00
R4190:Vmn2r84 UTSW 10 130391294 nonsense probably null
R4520:Vmn2r84 UTSW 10 130386522 missense probably damaging 1.00
R4584:Vmn2r84 UTSW 10 130390713 missense probably benign 0.00
R4588:Vmn2r84 UTSW 10 130385940 missense probably damaging 0.98
R4655:Vmn2r84 UTSW 10 130394104 nonsense probably null
R4860:Vmn2r84 UTSW 10 130385843 missense probably damaging 0.99
R4860:Vmn2r84 UTSW 10 130385843 missense probably damaging 0.99
R5022:Vmn2r84 UTSW 10 130386548 missense probably damaging 1.00
R5146:Vmn2r84 UTSW 10 130386102 missense probably damaging 1.00
R5237:Vmn2r84 UTSW 10 130385994 missense probably damaging 0.99
R5695:Vmn2r84 UTSW 10 130389195 missense probably benign 0.12
R5793:Vmn2r84 UTSW 10 130385885 missense probably damaging 0.99
R6210:Vmn2r84 UTSW 10 130386245 missense probably damaging 1.00
R6286:Vmn2r84 UTSW 10 130390868 missense possibly damaging 0.65
R6580:Vmn2r84 UTSW 10 130389241 missense possibly damaging 0.93
R6607:Vmn2r84 UTSW 10 130390862 missense possibly damaging 0.87
R6818:Vmn2r84 UTSW 10 130386278 missense probably benign 0.09
R6956:Vmn2r84 UTSW 10 130389267 missense probably damaging 0.98
R6994:Vmn2r84 UTSW 10 130391007 missense possibly damaging 0.90
R7075:Vmn2r84 UTSW 10 130391072 missense probably damaging 0.99
R7225:Vmn2r84 UTSW 10 130386683 missense probably damaging 0.99
R7252:Vmn2r84 UTSW 10 130386410 missense probably damaging 1.00
R7263:Vmn2r84 UTSW 10 130389208 missense probably damaging 1.00
R7297:Vmn2r84 UTSW 10 130391250 missense probably benign 0.19
R7439:Vmn2r84 UTSW 10 130392113 missense possibly damaging 0.90
R7441:Vmn2r84 UTSW 10 130392113 missense possibly damaging 0.90
R7857:Vmn2r84 UTSW 10 130390869 missense probably benign 0.00
R7940:Vmn2r84 UTSW 10 130390869 missense probably benign 0.00
Z1177:Vmn2r84 UTSW 10 130391902 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTGaacctccatcccttccc -3'
(R):5'- acacacacacCCCATGTTACTTGTTATT -3'

Sequencing Primer
(F):5'- tgatcttaaccacaaagctcttac -3'
Posted On2014-04-13