Incidental Mutation 'R1521:Map1b'
ID 167040
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Name microtubule-associated protein 1B
Synonyms Mtap1b, Mtap-5, MAP5, Mtap5, LC1
MMRRC Submission 040870-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1521 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 99557954-99653048 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99569247 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1158 (N1158S)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
AlphaFold P14873
Predicted Effect unknown
Transcript: ENSMUST00000064762
AA Change: N1158S
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: N1158S

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224702
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 112,713,867 (GRCm39) L104P possibly damaging Het
Adgrf5 T C 17: 43,741,443 (GRCm39) V360A probably benign Het
Ahnak G A 19: 8,982,092 (GRCm39) M1125I probably benign Het
Akap12 T C 10: 4,304,804 (GRCm39) V538A probably benign Het
Arhgef10l T C 4: 140,242,749 (GRCm39) D1088G possibly damaging Het
Atp7b A T 8: 22,517,689 (GRCm39) L268Q probably damaging Het
Atxn2 A C 5: 121,917,654 (GRCm39) N516T probably damaging Het
Cacna1h T C 17: 25,616,328 (GRCm39) M184V possibly damaging Het
Cacnb2 G T 2: 14,619,163 (GRCm39) R66L probably benign Het
Casp8ap2 A G 4: 32,631,867 (GRCm39) E96G probably damaging Het
Ccdc78 G T 17: 26,007,755 (GRCm39) R264L probably damaging Het
Cdh4 G A 2: 179,439,351 (GRCm39) R166H probably damaging Het
Cog7 C T 7: 121,529,797 (GRCm39) D615N possibly damaging Het
Crtc2 T C 3: 90,164,690 (GRCm39) V115A probably benign Het
Crybg1 A G 10: 43,874,412 (GRCm39) S899P probably damaging Het
Ctdnep1 T A 11: 69,879,461 (GRCm39) V128E probably damaging Het
Ctnna3 A G 10: 64,795,621 (GRCm39) K780E probably benign Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dazap2 T A 15: 100,515,946 (GRCm39) Y91* probably null Het
Dcdc5 T C 2: 106,182,014 (GRCm39) noncoding transcript Het
Dppa1 T A 11: 46,501,300 (GRCm39) R74S possibly damaging Het
Elovl1 A T 4: 118,289,197 (GRCm39) T241S probably benign Het
Eya1 G T 1: 14,344,774 (GRCm39) Q86K probably damaging Het
Fam110d T C 4: 133,978,661 (GRCm39) *272W probably null Het
Fancm A T 12: 65,168,478 (GRCm39) M1614L probably benign Het
Fcgbp C T 7: 27,774,585 (GRCm39) T53I probably benign Het
Fpr3 T A 17: 18,191,277 (GRCm39) W183R probably damaging Het
Galnt13 G A 2: 54,744,657 (GRCm39) V119I probably benign Het
Garin4 T A 1: 190,896,219 (GRCm39) R141S probably benign Het
Gcfc2 T C 6: 81,900,793 (GRCm39) S36P probably benign Het
Gdap2 T A 3: 100,101,931 (GRCm39) D412E possibly damaging Het
Gm12258 T C 11: 58,750,381 (GRCm39) C41R probably damaging Het
Hipk1 T G 3: 103,685,098 (GRCm39) E172D probably benign Het
Hmgcs1 T G 13: 120,165,127 (GRCm39) L326R probably benign Het
Hs6st1 C A 1: 36,107,967 (GRCm39) R77S probably damaging Het
Ifit3 A T 19: 34,564,573 (GRCm39) N40Y probably damaging Het
Il1a T A 2: 129,146,661 (GRCm39) Q144L possibly damaging Het
Itga7 A G 10: 128,793,680 (GRCm39) E1128G possibly damaging Het
Itih2 T C 2: 10,111,558 (GRCm39) D460G probably damaging Het
Ivns1abp G A 1: 151,227,309 (GRCm39) C39Y probably damaging Het
Kif22 G T 7: 126,627,011 (GRCm39) A646E probably damaging Het
Klhl29 T C 12: 5,141,307 (GRCm39) Y559C probably damaging Het
Klhl7 T A 5: 24,354,108 (GRCm39) probably null Het
Klhl9 A G 4: 88,640,230 (GRCm39) S4P probably benign Het
Klk10 A G 7: 43,432,304 (GRCm39) Q79R probably benign Het
Klk6 T C 7: 43,478,699 (GRCm39) probably null Het
Kpna2rt T A 17: 90,217,734 (GRCm39) N4I possibly damaging Het
Lamc2 C T 1: 153,042,009 (GRCm39) E42K probably benign Het
Lingo3 T C 10: 80,671,555 (GRCm39) D125G probably benign Het
Masp1 T A 16: 23,313,387 (GRCm39) N183Y probably damaging Het
Mdga2 A G 12: 66,615,700 (GRCm39) Y636H probably benign Het
Mical2 T A 7: 111,980,817 (GRCm39) S264T probably damaging Het
Mif A G 10: 75,695,375 (GRCm39) V95A possibly damaging Het
Mmp17 G A 5: 129,672,152 (GRCm39) probably null Het
Mmp23 T C 4: 155,735,174 (GRCm39) R390G possibly damaging Het
Ncoa6 A C 2: 155,257,142 (GRCm39) S800R possibly damaging Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Nr2e3 A T 9: 59,856,488 (GRCm39) S67R probably damaging Het
Odf2l T C 3: 144,854,797 (GRCm39) S545P possibly damaging Het
Or10d3 A T 9: 39,462,080 (GRCm39) V29E possibly damaging Het
Or4a47 G A 2: 89,665,516 (GRCm39) R258* probably null Het
Or52s1b T A 7: 102,822,658 (GRCm39) Y62F probably benign Het
Or5k1b C T 16: 58,581,216 (GRCm39) E108K probably damaging Het
Or7e176 A C 9: 20,171,728 (GRCm39) Q197H possibly damaging Het
Or7g27 C T 9: 19,249,948 (GRCm39) S64F probably benign Het
Or8b51 T G 9: 38,569,014 (GRCm39) I225L probably damaging Het
Otog A T 7: 45,908,688 (GRCm39) H562L possibly damaging Het
Pcdh15 T C 10: 74,430,023 (GRCm39) V1250A probably damaging Het
Pde1c A G 6: 56,150,592 (GRCm39) V309A possibly damaging Het
Pfkfb4 A C 9: 108,836,373 (GRCm39) T134P probably damaging Het
Phc3 G T 3: 30,990,724 (GRCm39) Q498K possibly damaging Het
Phlpp1 T C 1: 106,320,049 (GRCm39) V1348A probably damaging Het
Pik3ap1 T C 19: 41,309,997 (GRCm39) D441G probably damaging Het
Pkd1l2 T C 8: 117,792,239 (GRCm39) probably null Het
Pla2g4a T C 1: 149,733,437 (GRCm39) probably null Het
Pola2 A T 19: 5,998,434 (GRCm39) I376N probably damaging Het
Pold2 T A 11: 5,826,833 (GRCm39) N34Y probably damaging Het
Ppp2r5c T C 12: 110,521,320 (GRCm39) L281P probably damaging Het
Prss46 A G 9: 110,678,703 (GRCm39) I29V probably benign Het
Ranbp6 A T 19: 29,788,846 (GRCm39) V502E probably benign Het
Rdh14 T C 12: 10,444,613 (GRCm39) F155L probably damaging Het
Rnaseh2a A T 8: 85,692,487 (GRCm39) probably null Het
Rpp30 A G 19: 36,071,785 (GRCm39) T118A possibly damaging Het
Rragd T C 4: 32,996,005 (GRCm39) F117L probably damaging Het
Rxylt1 A G 10: 121,926,384 (GRCm39) W243R probably damaging Het
S100a2 T A 3: 90,498,599 (GRCm39) probably null Het
Septin12 T C 16: 4,814,340 (GRCm39) K43R probably damaging Het
Sh3tc2 A G 18: 62,141,559 (GRCm39) E1080G probably damaging Het
Slc26a9 A G 1: 131,678,415 (GRCm39) K27R probably damaging Het
Spata17 T A 1: 186,926,191 (GRCm39) K46N probably damaging Het
St14 A C 9: 31,019,511 (GRCm39) D103E probably benign Het
St6galnac2 T A 11: 116,575,173 (GRCm39) Q222L possibly damaging Het
Tdrd9 T C 12: 112,002,844 (GRCm39) V831A probably damaging Het
Tert A G 13: 73,790,175 (GRCm39) E843G probably damaging Het
Tex21 A G 12: 76,251,044 (GRCm39) V464A probably benign Het
Tmem232 T A 17: 65,791,496 (GRCm39) H124L probably damaging Het
Tnfrsf19 T G 14: 61,242,555 (GRCm39) S110R probably damaging Het
Tnnt3 A T 7: 142,069,562 (GRCm39) K272* probably null Het
Tnxb T C 17: 34,930,477 (GRCm39) L2054P probably damaging Het
Trcg1 A C 9: 57,149,748 (GRCm39) D440A probably benign Het
Trpm3 A G 19: 22,878,585 (GRCm39) E504G probably damaging Het
Trpm5 C T 7: 142,636,626 (GRCm39) R437H probably benign Het
Ttn T C 2: 76,571,511 (GRCm39) R18134G probably damaging Het
Uchl5 A C 1: 143,674,160 (GRCm39) M64L possibly damaging Het
Urb1 G A 16: 90,550,751 (GRCm39) R2034W probably damaging Het
Usp44 T A 10: 93,683,048 (GRCm39) C452* probably null Het
Uvssa G A 5: 33,571,278 (GRCm39) A641T probably damaging Het
Vmn1r204 T A 13: 22,741,248 (GRCm39) I293N probably benign Het
Vmn2r84 A T 10: 130,225,137 (GRCm39) C458S probably benign Het
Vmn2r85 T G 10: 130,261,788 (GRCm39) H183P probably damaging Het
Vps13d G T 4: 144,832,431 (GRCm39) T2825K probably benign Het
Zc3hc1 T A 6: 30,376,024 (GRCm39) I179F probably benign Het
Zfp112 A G 7: 23,825,210 (GRCm39) N393D probably damaging Het
Zfp558 A G 9: 18,367,859 (GRCm39) S310P possibly damaging Het
Zfp560 A C 9: 20,260,071 (GRCm39) probably null Het
Zfp668 C T 7: 127,466,252 (GRCm39) E311K probably benign Het
Zfp763 T A 17: 33,252,276 (GRCm39) M1L probably benign Het
Zfp947 A T 17: 22,364,813 (GRCm39) M287K probably benign Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99,565,741 (GRCm39) missense unknown
IGL00533:Map1b APN 13 99,569,112 (GRCm39) missense unknown
IGL00801:Map1b APN 13 99,566,605 (GRCm39) missense unknown
IGL01141:Map1b APN 13 99,571,269 (GRCm39) missense probably damaging 1.00
IGL01418:Map1b APN 13 99,568,338 (GRCm39) missense unknown
IGL01464:Map1b APN 13 99,569,251 (GRCm39) missense unknown
IGL01690:Map1b APN 13 99,571,512 (GRCm39) missense probably damaging 1.00
IGL01991:Map1b APN 13 99,566,077 (GRCm39) missense unknown
IGL02245:Map1b APN 13 99,568,036 (GRCm39) missense unknown
IGL02376:Map1b APN 13 99,572,103 (GRCm39) missense probably damaging 1.00
IGL02380:Map1b APN 13 99,567,651 (GRCm39) missense unknown
IGL02442:Map1b APN 13 99,644,706 (GRCm39) missense probably damaging 1.00
IGL02465:Map1b APN 13 99,569,914 (GRCm39) missense unknown
IGL02816:Map1b APN 13 99,578,263 (GRCm39) missense probably damaging 1.00
IGL02859:Map1b APN 13 99,569,544 (GRCm39) missense unknown
IGL02934:Map1b APN 13 99,571,639 (GRCm39) missense probably benign 0.09
IGL02970:Map1b APN 13 99,567,242 (GRCm39) nonsense probably null
IGL03148:Map1b APN 13 99,578,203 (GRCm39) missense probably damaging 1.00
IGL03401:Map1b APN 13 99,563,776 (GRCm39) missense unknown
IGL03138:Map1b UTSW 13 99,562,334 (GRCm39) missense unknown
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0035:Map1b UTSW 13 99,571,846 (GRCm39) missense probably damaging 1.00
R0069:Map1b UTSW 13 99,566,356 (GRCm39) missense unknown
R0315:Map1b UTSW 13 99,567,624 (GRCm39) missense unknown
R0539:Map1b UTSW 13 99,570,526 (GRCm39) missense unknown
R0548:Map1b UTSW 13 99,568,191 (GRCm39) missense unknown
R0613:Map1b UTSW 13 99,578,149 (GRCm39) missense probably damaging 1.00
R0730:Map1b UTSW 13 99,566,274 (GRCm39) nonsense probably null
R1103:Map1b UTSW 13 99,563,974 (GRCm39) splice site probably benign
R1300:Map1b UTSW 13 99,569,029 (GRCm39) missense unknown
R1353:Map1b UTSW 13 99,563,834 (GRCm39) missense unknown
R1387:Map1b UTSW 13 99,569,158 (GRCm39) missense unknown
R1481:Map1b UTSW 13 99,567,679 (GRCm39) missense unknown
R1509:Map1b UTSW 13 99,568,036 (GRCm39) missense unknown
R1604:Map1b UTSW 13 99,566,080 (GRCm39) missense unknown
R1649:Map1b UTSW 13 99,652,986 (GRCm39) missense probably benign 0.03
R1651:Map1b UTSW 13 99,569,091 (GRCm39) missense unknown
R1661:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1665:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1770:Map1b UTSW 13 99,567,001 (GRCm39) missense unknown
R1926:Map1b UTSW 13 99,567,200 (GRCm39) missense unknown
R1928:Map1b UTSW 13 99,567,454 (GRCm39) missense unknown
R2093:Map1b UTSW 13 99,566,178 (GRCm39) missense unknown
R2110:Map1b UTSW 13 99,567,629 (GRCm39) missense unknown
R2116:Map1b UTSW 13 99,567,152 (GRCm39) missense unknown
R2164:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R2207:Map1b UTSW 13 99,567,591 (GRCm39) missense unknown
R2273:Map1b UTSW 13 99,568,592 (GRCm39) missense unknown
R2443:Map1b UTSW 13 99,566,919 (GRCm39) missense unknown
R3054:Map1b UTSW 13 99,569,250 (GRCm39) missense unknown
R3766:Map1b UTSW 13 99,570,595 (GRCm39) missense unknown
R3911:Map1b UTSW 13 99,567,580 (GRCm39) missense unknown
R4005:Map1b UTSW 13 99,566,415 (GRCm39) missense unknown
R4130:Map1b UTSW 13 99,568,188 (GRCm39) missense unknown
R4513:Map1b UTSW 13 99,580,741 (GRCm39) missense probably damaging 1.00
R4613:Map1b UTSW 13 99,566,810 (GRCm39) nonsense probably null
R4633:Map1b UTSW 13 99,571,450 (GRCm39) missense probably damaging 1.00
R4646:Map1b UTSW 13 99,568,977 (GRCm39) missense unknown
R4690:Map1b UTSW 13 99,567,576 (GRCm39) missense unknown
R4704:Map1b UTSW 13 99,566,983 (GRCm39) missense unknown
R4836:Map1b UTSW 13 99,567,562 (GRCm39) missense unknown
R4916:Map1b UTSW 13 99,569,808 (GRCm39) missense unknown
R4951:Map1b UTSW 13 99,568,935 (GRCm39) missense unknown
R4960:Map1b UTSW 13 99,568,720 (GRCm39) missense probably benign 0.23
R4961:Map1b UTSW 13 99,572,161 (GRCm39) missense probably damaging 1.00
R5030:Map1b UTSW 13 99,570,682 (GRCm39) missense unknown
R5090:Map1b UTSW 13 99,566,534 (GRCm39) nonsense probably null
R5469:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R5820:Map1b UTSW 13 99,569,332 (GRCm39) missense unknown
R5885:Map1b UTSW 13 99,566,589 (GRCm39) missense unknown
R5915:Map1b UTSW 13 99,566,839 (GRCm39) missense unknown
R5923:Map1b UTSW 13 99,569,661 (GRCm39) missense unknown
R6063:Map1b UTSW 13 99,567,645 (GRCm39) missense unknown
R6102:Map1b UTSW 13 99,562,381 (GRCm39) missense unknown
R6218:Map1b UTSW 13 99,569,714 (GRCm39) missense unknown
R6435:Map1b UTSW 13 99,652,871 (GRCm39) missense probably damaging 0.99
R6663:Map1b UTSW 13 99,566,530 (GRCm39) missense unknown
R6765:Map1b UTSW 13 99,562,449 (GRCm39) missense unknown
R6860:Map1b UTSW 13 99,571,275 (GRCm39) missense probably damaging 1.00
R6997:Map1b UTSW 13 99,567,142 (GRCm39) missense unknown
R7001:Map1b UTSW 13 99,567,101 (GRCm39) missense unknown
R7310:Map1b UTSW 13 99,570,163 (GRCm39) missense unknown
R7349:Map1b UTSW 13 99,570,148 (GRCm39) missense unknown
R7448:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7449:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7452:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7810:Map1b UTSW 13 99,568,390 (GRCm39) missense unknown
R7820:Map1b UTSW 13 99,567,685 (GRCm39) missense unknown
R8396:Map1b UTSW 13 99,570,621 (GRCm39) missense unknown
R8470:Map1b UTSW 13 99,652,950 (GRCm39) missense probably damaging 0.98
R8535:Map1b UTSW 13 99,571,662 (GRCm39) missense probably damaging 1.00
R8777:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8777-TAIL:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8812:Map1b UTSW 13 99,569,323 (GRCm39) missense unknown
R8903:Map1b UTSW 13 99,569,017 (GRCm39) nonsense probably null
R8928:Map1b UTSW 13 99,568,624 (GRCm39) missense unknown
R8954:Map1b UTSW 13 99,570,735 (GRCm39) missense unknown
R9164:Map1b UTSW 13 99,568,816 (GRCm39) nonsense probably null
R9164:Map1b UTSW 13 99,562,351 (GRCm39) missense unknown
R9190:Map1b UTSW 13 99,571,914 (GRCm39) missense probably damaging 0.99
R9334:Map1b UTSW 13 99,568,148 (GRCm39) missense unknown
R9339:Map1b UTSW 13 99,567,570 (GRCm39) missense unknown
R9357:Map1b UTSW 13 99,566,708 (GRCm39) nonsense probably null
R9430:Map1b UTSW 13 99,570,616 (GRCm39) missense unknown
RF003:Map1b UTSW 13 99,567,258 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,568,920 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,566,476 (GRCm39) missense unknown
Z1088:Map1b UTSW 13 99,644,623 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TCTAACTCGGCACTGGCTTTCAAC -3'
(R):5'- GGAAGACCAGCCTGAGGAATTCAC -3'

Sequencing Primer
(F):5'- TCTTCTGAGCAGTAAGCATCACG -3'
(R):5'- GAGGAATTCACTGCTACCTCTGG -3'
Posted On 2014-04-13