Incidental Mutation 'R1521:Or5k1b'
ID 167048
Institutional Source Beutler Lab
Gene Symbol Or5k1b
Ensembl Gene ENSMUSG00000071510
Gene Name olfactory receptor family 5 subfamily K member 1B
Synonyms GA_x54KRFPKG5P-54930346-54929417, MOR184-2, Olfr172
MMRRC Submission 040870-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R1521 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 58580515-58581603 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 58581216 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 108 (E108K)
Ref Sequence ENSEMBL: ENSMUSP00000150908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095991] [ENSMUST00000214139]
AlphaFold E9Q8F6
Predicted Effect probably damaging
Transcript: ENSMUST00000095991
AA Change: E108K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093690
Gene: ENSMUSG00000071510
AA Change: E108K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.9e-52 PFAM
Pfam:7tm_1 41 290 3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214139
AA Change: E108K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adat1 A G 8: 112,713,867 (GRCm39) L104P possibly damaging Het
Adgrf5 T C 17: 43,741,443 (GRCm39) V360A probably benign Het
Ahnak G A 19: 8,982,092 (GRCm39) M1125I probably benign Het
Akap12 T C 10: 4,304,804 (GRCm39) V538A probably benign Het
Arhgef10l T C 4: 140,242,749 (GRCm39) D1088G possibly damaging Het
Atp7b A T 8: 22,517,689 (GRCm39) L268Q probably damaging Het
Atxn2 A C 5: 121,917,654 (GRCm39) N516T probably damaging Het
Cacna1h T C 17: 25,616,328 (GRCm39) M184V possibly damaging Het
Cacnb2 G T 2: 14,619,163 (GRCm39) R66L probably benign Het
Casp8ap2 A G 4: 32,631,867 (GRCm39) E96G probably damaging Het
Ccdc78 G T 17: 26,007,755 (GRCm39) R264L probably damaging Het
Cdh4 G A 2: 179,439,351 (GRCm39) R166H probably damaging Het
Cog7 C T 7: 121,529,797 (GRCm39) D615N possibly damaging Het
Crtc2 T C 3: 90,164,690 (GRCm39) V115A probably benign Het
Crybg1 A G 10: 43,874,412 (GRCm39) S899P probably damaging Het
Ctdnep1 T A 11: 69,879,461 (GRCm39) V128E probably damaging Het
Ctnna3 A G 10: 64,795,621 (GRCm39) K780E probably benign Het
Cul7 T A 17: 46,974,116 (GRCm39) L1467H probably damaging Het
Dazap2 T A 15: 100,515,946 (GRCm39) Y91* probably null Het
Dcdc5 T C 2: 106,182,014 (GRCm39) noncoding transcript Het
Dppa1 T A 11: 46,501,300 (GRCm39) R74S possibly damaging Het
Elovl1 A T 4: 118,289,197 (GRCm39) T241S probably benign Het
Eya1 G T 1: 14,344,774 (GRCm39) Q86K probably damaging Het
Fam110d T C 4: 133,978,661 (GRCm39) *272W probably null Het
Fancm A T 12: 65,168,478 (GRCm39) M1614L probably benign Het
Fcgbp C T 7: 27,774,585 (GRCm39) T53I probably benign Het
Fpr3 T A 17: 18,191,277 (GRCm39) W183R probably damaging Het
Galnt13 G A 2: 54,744,657 (GRCm39) V119I probably benign Het
Garin4 T A 1: 190,896,219 (GRCm39) R141S probably benign Het
Gcfc2 T C 6: 81,900,793 (GRCm39) S36P probably benign Het
Gdap2 T A 3: 100,101,931 (GRCm39) D412E possibly damaging Het
Gm12258 T C 11: 58,750,381 (GRCm39) C41R probably damaging Het
Hipk1 T G 3: 103,685,098 (GRCm39) E172D probably benign Het
Hmgcs1 T G 13: 120,165,127 (GRCm39) L326R probably benign Het
Hs6st1 C A 1: 36,107,967 (GRCm39) R77S probably damaging Het
Ifit3 A T 19: 34,564,573 (GRCm39) N40Y probably damaging Het
Il1a T A 2: 129,146,661 (GRCm39) Q144L possibly damaging Het
Itga7 A G 10: 128,793,680 (GRCm39) E1128G possibly damaging Het
Itih2 T C 2: 10,111,558 (GRCm39) D460G probably damaging Het
Ivns1abp G A 1: 151,227,309 (GRCm39) C39Y probably damaging Het
Kif22 G T 7: 126,627,011 (GRCm39) A646E probably damaging Het
Klhl29 T C 12: 5,141,307 (GRCm39) Y559C probably damaging Het
Klhl7 T A 5: 24,354,108 (GRCm39) probably null Het
Klhl9 A G 4: 88,640,230 (GRCm39) S4P probably benign Het
Klk10 A G 7: 43,432,304 (GRCm39) Q79R probably benign Het
Klk6 T C 7: 43,478,699 (GRCm39) probably null Het
Kpna2rt T A 17: 90,217,734 (GRCm39) N4I possibly damaging Het
Lamc2 C T 1: 153,042,009 (GRCm39) E42K probably benign Het
Lingo3 T C 10: 80,671,555 (GRCm39) D125G probably benign Het
Map1b T C 13: 99,569,247 (GRCm39) N1158S unknown Het
Masp1 T A 16: 23,313,387 (GRCm39) N183Y probably damaging Het
Mdga2 A G 12: 66,615,700 (GRCm39) Y636H probably benign Het
Mical2 T A 7: 111,980,817 (GRCm39) S264T probably damaging Het
Mif A G 10: 75,695,375 (GRCm39) V95A possibly damaging Het
Mmp17 G A 5: 129,672,152 (GRCm39) probably null Het
Mmp23 T C 4: 155,735,174 (GRCm39) R390G possibly damaging Het
Ncoa6 A C 2: 155,257,142 (GRCm39) S800R possibly damaging Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Nr2e3 A T 9: 59,856,488 (GRCm39) S67R probably damaging Het
Odf2l T C 3: 144,854,797 (GRCm39) S545P possibly damaging Het
Or10d3 A T 9: 39,462,080 (GRCm39) V29E possibly damaging Het
Or4a47 G A 2: 89,665,516 (GRCm39) R258* probably null Het
Or52s1b T A 7: 102,822,658 (GRCm39) Y62F probably benign Het
Or7e176 A C 9: 20,171,728 (GRCm39) Q197H possibly damaging Het
Or7g27 C T 9: 19,249,948 (GRCm39) S64F probably benign Het
Or8b51 T G 9: 38,569,014 (GRCm39) I225L probably damaging Het
Otog A T 7: 45,908,688 (GRCm39) H562L possibly damaging Het
Pcdh15 T C 10: 74,430,023 (GRCm39) V1250A probably damaging Het
Pde1c A G 6: 56,150,592 (GRCm39) V309A possibly damaging Het
Pfkfb4 A C 9: 108,836,373 (GRCm39) T134P probably damaging Het
Phc3 G T 3: 30,990,724 (GRCm39) Q498K possibly damaging Het
Phlpp1 T C 1: 106,320,049 (GRCm39) V1348A probably damaging Het
Pik3ap1 T C 19: 41,309,997 (GRCm39) D441G probably damaging Het
Pkd1l2 T C 8: 117,792,239 (GRCm39) probably null Het
Pla2g4a T C 1: 149,733,437 (GRCm39) probably null Het
Pola2 A T 19: 5,998,434 (GRCm39) I376N probably damaging Het
Pold2 T A 11: 5,826,833 (GRCm39) N34Y probably damaging Het
Ppp2r5c T C 12: 110,521,320 (GRCm39) L281P probably damaging Het
Prss46 A G 9: 110,678,703 (GRCm39) I29V probably benign Het
Ranbp6 A T 19: 29,788,846 (GRCm39) V502E probably benign Het
Rdh14 T C 12: 10,444,613 (GRCm39) F155L probably damaging Het
Rnaseh2a A T 8: 85,692,487 (GRCm39) probably null Het
Rpp30 A G 19: 36,071,785 (GRCm39) T118A possibly damaging Het
Rragd T C 4: 32,996,005 (GRCm39) F117L probably damaging Het
Rxylt1 A G 10: 121,926,384 (GRCm39) W243R probably damaging Het
S100a2 T A 3: 90,498,599 (GRCm39) probably null Het
Septin12 T C 16: 4,814,340 (GRCm39) K43R probably damaging Het
Sh3tc2 A G 18: 62,141,559 (GRCm39) E1080G probably damaging Het
Slc26a9 A G 1: 131,678,415 (GRCm39) K27R probably damaging Het
Spata17 T A 1: 186,926,191 (GRCm39) K46N probably damaging Het
St14 A C 9: 31,019,511 (GRCm39) D103E probably benign Het
St6galnac2 T A 11: 116,575,173 (GRCm39) Q222L possibly damaging Het
Tdrd9 T C 12: 112,002,844 (GRCm39) V831A probably damaging Het
Tert A G 13: 73,790,175 (GRCm39) E843G probably damaging Het
Tex21 A G 12: 76,251,044 (GRCm39) V464A probably benign Het
Tmem232 T A 17: 65,791,496 (GRCm39) H124L probably damaging Het
Tnfrsf19 T G 14: 61,242,555 (GRCm39) S110R probably damaging Het
Tnnt3 A T 7: 142,069,562 (GRCm39) K272* probably null Het
Tnxb T C 17: 34,930,477 (GRCm39) L2054P probably damaging Het
Trcg1 A C 9: 57,149,748 (GRCm39) D440A probably benign Het
Trpm3 A G 19: 22,878,585 (GRCm39) E504G probably damaging Het
Trpm5 C T 7: 142,636,626 (GRCm39) R437H probably benign Het
Ttn T C 2: 76,571,511 (GRCm39) R18134G probably damaging Het
Uchl5 A C 1: 143,674,160 (GRCm39) M64L possibly damaging Het
Urb1 G A 16: 90,550,751 (GRCm39) R2034W probably damaging Het
Usp44 T A 10: 93,683,048 (GRCm39) C452* probably null Het
Uvssa G A 5: 33,571,278 (GRCm39) A641T probably damaging Het
Vmn1r204 T A 13: 22,741,248 (GRCm39) I293N probably benign Het
Vmn2r84 A T 10: 130,225,137 (GRCm39) C458S probably benign Het
Vmn2r85 T G 10: 130,261,788 (GRCm39) H183P probably damaging Het
Vps13d G T 4: 144,832,431 (GRCm39) T2825K probably benign Het
Zc3hc1 T A 6: 30,376,024 (GRCm39) I179F probably benign Het
Zfp112 A G 7: 23,825,210 (GRCm39) N393D probably damaging Het
Zfp558 A G 9: 18,367,859 (GRCm39) S310P possibly damaging Het
Zfp560 A C 9: 20,260,071 (GRCm39) probably null Het
Zfp668 C T 7: 127,466,252 (GRCm39) E311K probably benign Het
Zfp763 T A 17: 33,252,276 (GRCm39) M1L probably benign Het
Zfp947 A T 17: 22,364,813 (GRCm39) M287K probably benign Het
Other mutations in Or5k1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03006:Or5k1b APN 16 58,581,511 (GRCm39) missense probably benign 0.01
R1210:Or5k1b UTSW 16 58,581,413 (GRCm39) missense probably damaging 1.00
R1710:Or5k1b UTSW 16 58,581,504 (GRCm39) missense probably benign 0.02
R4730:Or5k1b UTSW 16 58,581,105 (GRCm39) missense probably benign 0.00
R4784:Or5k1b UTSW 16 58,580,911 (GRCm39) missense probably damaging 1.00
R4924:Or5k1b UTSW 16 58,580,982 (GRCm39) nonsense probably null
R5213:Or5k1b UTSW 16 58,580,984 (GRCm39) missense probably damaging 1.00
R5967:Or5k1b UTSW 16 58,580,725 (GRCm39) missense probably damaging 1.00
R7022:Or5k1b UTSW 16 58,581,482 (GRCm39) missense probably benign 0.00
R7259:Or5k1b UTSW 16 58,580,868 (GRCm39) missense possibly damaging 0.92
R7745:Or5k1b UTSW 16 58,580,782 (GRCm39) nonsense probably null
R7983:Or5k1b UTSW 16 58,581,377 (GRCm39) missense probably benign 0.37
R8123:Or5k1b UTSW 16 58,581,537 (GRCm39) start codon destroyed possibly damaging 0.91
R8189:Or5k1b UTSW 16 58,581,288 (GRCm39) missense probably damaging 1.00
R9245:Or5k1b UTSW 16 58,581,126 (GRCm39) nonsense probably null
R9464:Or5k1b UTSW 16 58,581,202 (GRCm39) nonsense probably null
R9686:Or5k1b UTSW 16 58,581,126 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACAAGCTCATTGACATAGGGGTCAAC -3'
(R):5'- GCTTGGTGATTCTGATTTGCACAGAAC -3'

Sequencing Primer
(F):5'- TTAGACCCACAGAATGCTAGTC -3'
(R):5'- ACGTTCTCTTCACACCCCAATG -3'
Posted On 2014-04-13